\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709679219:

Variant ID: vg0709679219 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9679219
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TATACCCGTACCAAAGCATCTCCCAGATAAGCTAGCCATATATTCAGTATAACATGAACATAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCA[G/A]
TACCACAAATGTATATATAGAAGAGTATTCTAATAAAACTACAAAGCTCACAAAAGAGAAGTGAAAAGCTACTAGAGCCATACCCGAACTCTTCCGAAGA

Reverse complement sequence

TCTTCGGAAGAGTTCGGGTATGGCTCTAGTAGCTTTTCACTTCTCTTTTGTGAGCTTTGTAGTTTTATTAGAATACTCTTCTATATATACATTTGTGGTA[C/T]
TGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTATGTTCATGTTATACTGAATATATGGCTAGCTTATCTGGGAGATGCTTTGGTACGGGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.00% 1.00% 11.26% 39.74% NA
All Indica  2759 18.20% 1.70% 16.82% 63.28% NA
All Japonica  1512 93.10% 0.00% 3.04% 3.84% NA
Aus  269 85.10% 0.00% 1.86% 13.01% NA
Indica I  595 29.70% 2.20% 15.80% 52.27% NA
Indica II  465 7.70% 0.60% 20.00% 71.61% NA
Indica III  913 8.00% 2.20% 17.52% 72.29% NA
Indica Intermediate  786 27.60% 1.30% 14.89% 56.23% NA
Temperate Japonica  767 95.40% 0.00% 1.04% 3.52% NA
Tropical Japonica  504 92.50% 0.00% 5.95% 1.59% NA
Japonica Intermediate  241 87.10% 0.00% 3.32% 9.54% NA
VI/Aromatic  96 82.30% 0.00% 7.29% 10.42% NA
Intermediate  90 56.70% 0.00% 11.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709679219 G -> DEL N N silent_mutation Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0709679219 G -> A LOC_Os07g16510.1 upstream_gene_variant ; 1178.0bp to feature; MODIFIER silent_mutation Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0709679219 G -> A LOC_Os07g16500.1 downstream_gene_variant ; 3388.0bp to feature; MODIFIER silent_mutation Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0709679219 G -> A LOC_Os07g16520.1 downstream_gene_variant ; 3922.0bp to feature; MODIFIER silent_mutation Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0709679219 G -> A LOC_Os07g16510-LOC_Os07g16520 intergenic_region ; MODIFIER silent_mutation Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709679219 NA 2.11E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 1.18E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 1.12E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 1.23E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 1.08E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 3.44E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 8.25E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 8.12E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 2.61E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 5.91E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 4.13E-34 mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 1.08E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 5.00E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 4.60E-33 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 8.02E-23 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 1.87E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219 NA 5.55E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251