Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709679219:

Variant ID: vg0709679219 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9679219
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TATACCCGTACCAAAGCATCTCCCAGATAAGCTAGCCATATATTCAGTATAACATGAACATAATGTAAAGTAGGTACTCATATACTCGGAAAGTATTTCA[G/A]
TACCACAAATGTATATATAGAAGAGTATTCTAATAAAACTACAAAGCTCACAAAAGAGAAGTGAAAAGCTACTAGAGCCATACCCGAACTCTTCCGAAGA

Reverse complement sequence

TCTTCGGAAGAGTTCGGGTATGGCTCTAGTAGCTTTTCACTTCTCTTTTGTGAGCTTTGTAGTTTTATTAGAATACTCTTCTATATATACATTTGTGGTA[C/T]
TGAAATACTTTCCGAGTATATGAGTACCTACTTTACATTATGTTCATGTTATACTGAATATATGGCTAGCTTATCTGGGAGATGCTTTGGTACGGGTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.00%	1.00%	11.26%	39.74%	NA
All Indica	2759	18.20%	1.70%	16.82%	63.28%	NA
All Japonica	1512	93.10%	0.00%	3.04%	3.84%	NA
Aus	269	85.10%	0.00%	1.86%	13.01%	NA
Indica I	595	29.70%	2.20%	15.80%	52.27%	NA
Indica II	465	7.70%	0.60%	20.00%	71.61%	NA
Indica III	913	8.00%	2.20%	17.52%	72.29%	NA
Indica Intermediate	786	27.60%	1.30%	14.89%	56.23%	NA
Temperate Japonica	767	95.40%	0.00%	1.04%	3.52%	NA
Tropical Japonica	504	92.50%	0.00%	5.95%	1.59%	NA
Japonica Intermediate	241	87.10%	0.00%	3.32%	9.54%	NA
VI/Aromatic	96	82.30%	0.00%	7.29%	10.42%	NA
Intermediate	90	56.70%	0.00%	11.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709679219	G -> DEL	N	N	silent_mutation	Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0709679219	G -> A	LOC_Os07g16510.1	upstream_gene_variant ; 1178.0bp to feature; MODIFIER	silent_mutation	Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0709679219	G -> A	LOC_Os07g16500.1	downstream_gene_variant ; 3388.0bp to feature; MODIFIER	silent_mutation	Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0709679219	G -> A	LOC_Os07g16520.1	downstream_gene_variant ; 3922.0bp to feature; MODIFIER	silent_mutation	Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N
vg0709679219	G -> A	LOC_Os07g16510-LOC_Os07g16520	intergenic_region ; MODIFIER	silent_mutation	Average:26.313; most accessible tissue: Zhenshan97 root, score: 32.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709679219	NA	2.11E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	1.18E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	1.12E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	1.23E-09	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	1.08E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	3.44E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	8.25E-17	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	8.12E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	2.61E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	5.91E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	4.13E-34	mr1580_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	1.08E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	5.00E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	4.60E-33	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	8.02E-23	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	1.87E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709679219	NA	5.55E-27	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251