\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709678550:

Variant ID: vg0709678550 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9678550
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCAGCAATGGCGCATAAATACTTCTGGTATATTATGGTTACAGAGTTCATCCGCAGGCGCACGGACATACCATTATACCGTTTCACCCGAGAGTATTC[C/T]
AAGGGTATTGTATTTATTTTATCCCGTGGCAAGATCATGTAGAGATAACTCAACTAATAATTTATATATTACTTGAGATAATCATATTCTAAGCAGGGGT

Reverse complement sequence

ACCCCTGCTTAGAATATGATTATCTCAAGTAATATATAAATTATTAGTTGAGTTATCTCTACATGATCTTGCCACGGGATAAAATAAATACAATACCCTT[G/A]
GAATACTCTCGGGTGAAACGGTATAATGGTATGTCCGTGCGCCTGCGGATGAACTCTGTAACCATAATATACCAGAAGTATTTATGCGCCATTGCTGGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.60% 46.50% 2.81% 4.04% NA
All Indica  2759 75.90% 16.80% 2.54% 4.75% NA
All Japonica  1512 1.40% 91.50% 3.64% 3.44% NA
Aus  269 13.40% 84.80% 0.00% 1.86% NA
Indica I  595 59.70% 27.40% 4.54% 8.40% NA
Indica II  465 88.00% 6.70% 1.29% 4.09% NA
Indica III  913 88.70% 7.00% 2.30% 1.97% NA
Indica Intermediate  786 66.20% 26.20% 2.04% 5.60% NA
Temperate Japonica  767 1.80% 95.30% 0.13% 2.74% NA
Tropical Japonica  504 0.80% 88.10% 10.12% 0.99% NA
Japonica Intermediate  241 1.20% 86.70% 1.24% 10.79% NA
VI/Aromatic  96 15.60% 77.10% 5.21% 2.08% NA
Intermediate  90 41.10% 54.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709678550 C -> DEL N N silent_mutation Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg0709678550 C -> T LOC_Os07g16510.1 upstream_gene_variant ; 509.0bp to feature; MODIFIER silent_mutation Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg0709678550 C -> T LOC_Os07g16500.1 downstream_gene_variant ; 2719.0bp to feature; MODIFIER silent_mutation Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg0709678550 C -> T LOC_Os07g16520.1 downstream_gene_variant ; 4591.0bp to feature; MODIFIER silent_mutation Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg0709678550 C -> T LOC_Os07g16510-LOC_Os07g16520 intergenic_region ; MODIFIER silent_mutation Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709678550 NA 1.26E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 NA 1.31E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 NA 6.52E-33 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 1.27E-06 NA mr1624_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 NA 2.35E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 NA 1.30E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 NA 7.34E-32 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709678550 NA 4.93E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251