\
| Variant ID: vg0709678550 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9678550 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCCCAGCAATGGCGCATAAATACTTCTGGTATATTATGGTTACAGAGTTCATCCGCAGGCGCACGGACATACCATTATACCGTTTCACCCGAGAGTATTC[C/T]
AAGGGTATTGTATTTATTTTATCCCGTGGCAAGATCATGTAGAGATAACTCAACTAATAATTTATATATTACTTGAGATAATCATATTCTAAGCAGGGGT
ACCCCTGCTTAGAATATGATTATCTCAAGTAATATATAAATTATTAGTTGAGTTATCTCTACATGATCTTGCCACGGGATAAAATAAATACAATACCCTT[G/A]
GAATACTCTCGGGTGAAACGGTATAATGGTATGTCCGTGCGCCTGCGGATGAACTCTGTAACCATAATATACCAGAAGTATTTATGCGCCATTGCTGGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.60% | 46.50% | 2.81% | 4.04% | NA |
| All Indica | 2759 | 75.90% | 16.80% | 2.54% | 4.75% | NA |
| All Japonica | 1512 | 1.40% | 91.50% | 3.64% | 3.44% | NA |
| Aus | 269 | 13.40% | 84.80% | 0.00% | 1.86% | NA |
| Indica I | 595 | 59.70% | 27.40% | 4.54% | 8.40% | NA |
| Indica II | 465 | 88.00% | 6.70% | 1.29% | 4.09% | NA |
| Indica III | 913 | 88.70% | 7.00% | 2.30% | 1.97% | NA |
| Indica Intermediate | 786 | 66.20% | 26.20% | 2.04% | 5.60% | NA |
| Temperate Japonica | 767 | 1.80% | 95.30% | 0.13% | 2.74% | NA |
| Tropical Japonica | 504 | 0.80% | 88.10% | 10.12% | 0.99% | NA |
| Japonica Intermediate | 241 | 1.20% | 86.70% | 1.24% | 10.79% | NA |
| VI/Aromatic | 96 | 15.60% | 77.10% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 41.10% | 54.40% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709678550 | C -> DEL | N | N | silent_mutation | Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg0709678550 | C -> T | LOC_Os07g16510.1 | upstream_gene_variant ; 509.0bp to feature; MODIFIER | silent_mutation | Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg0709678550 | C -> T | LOC_Os07g16500.1 | downstream_gene_variant ; 2719.0bp to feature; MODIFIER | silent_mutation | Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg0709678550 | C -> T | LOC_Os07g16520.1 | downstream_gene_variant ; 4591.0bp to feature; MODIFIER | silent_mutation | Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| vg0709678550 | C -> T | LOC_Os07g16510-LOC_Os07g16520 | intergenic_region ; MODIFIER | silent_mutation | Average:26.384; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709678550 | NA | 1.26E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | NA | 1.31E-07 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | NA | 6.52E-33 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | 1.27E-06 | NA | mr1624_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | NA | 2.35E-07 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | NA | 1.30E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | NA | 7.34E-32 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709678550 | NA | 4.93E-21 | mr1924_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |