\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709675216:

Variant ID: vg0709675216 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9675216
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCCAGCAAGACTCTTCGCGAGTTCGCTGCTCCCTCTGCTGATAATGTGGCCATTGGGCCACAAGTCAACATAGGAGATGTGGATTTTGACTTGAAATC[C/A]
AGCCTTATCATGATGGCGCAGGCTAGCCCGTTCTGTGGCAAGCCTAATGAGGATGCCAACGCTCATCTGCAACAATTCCTGGAGATATGTAGCACGTACA

Reverse complement sequence

TGTACGTGCTACATATCTCCAGGAATTGTTGCAGATGAGCGTTGGCATCCTCATTAGGCTTGCCACAGAACGGGCTAGCCTGCGCCATCATGATAAGGCT[G/T]
GATTTCAAGTCAAAATCCACATCTCCTATGTTGACTTGTGGCCCAATGGCCACATTATCAGCAGAGGGAGCAGCGAACTCGCGAAGAGTCTTGCTGGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 0.40% 1.21% 0.53% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 93.60% 1.40% 3.44% 1.59% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 96.50% 0.80% 2.61% 0.13% NA
Tropical Japonica  504 92.10% 1.40% 2.38% 4.17% NA
Japonica Intermediate  241 87.60% 3.30% 8.30% 0.83% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 97.80% 0.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709675216 C -> DEL LOC_Os07g16500.1 N frameshift_variant Average:53.442; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N
vg0709675216 C -> A LOC_Os07g16500.1 synonymous_variant ; p.Ser78Ser; LOW synonymous_codon Average:53.442; most accessible tissue: Minghui63 flag leaf, score: 71.116 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709675216 1.36E-06 1.36E-06 mr1098 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 7.44E-07 7.44E-07 mr1099 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 7.50E-07 2.49E-07 mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 7.02E-07 3.11E-08 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 3.08E-07 1.55E-07 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 3.45E-06 4.61E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 NA 7.00E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 8.05E-06 5.66E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 4.16E-09 4.62E-10 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 3.83E-06 1.08E-07 mr1150 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 NA 4.47E-06 mr1239 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 3.09E-07 1.35E-08 mr1240 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 1.78E-06 3.59E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 1.03E-06 3.59E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 NA 2.33E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 2.02E-06 2.02E-06 mr1868 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 2.01E-06 1.55E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 8.36E-07 3.50E-08 mr1936 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 3.12E-07 4.32E-08 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709675216 5.50E-06 1.06E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251