\
| Variant ID: vg0709674724 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9674724 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GATTATCTTAACCCCTGCTTATAATTTATATATCACAAGTAATATATAAATTATTAGTTGAGTTCTCTCTACATGATCTTCCCACGGGATAAAATAAATA[C/T]
GATACCCTTGGAATACTTTCGGGTGAAATGTTCCAATGGTATATCCGTGCACTTGCGGATAAACTCCGTAACCATAATATACCAGAAGTATTTCTGCGCC
GGCGCAGAAATACTTCTGGTATATTATGGTTACGGAGTTTATCCGCAAGTGCACGGATATACCATTGGAACATTTCACCCGAAAGTATTCCAAGGGTATC[G/A]
TATTTATTTTATCCCGTGGGAAGATCATGTAGAGAGAACTCAACTAATAATTTATATATTACTTGTGATATATAAATTATAAGCAGGGGTTAAGATAATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 41.40% | 1.31% | 5.37% | NA |
| All Indica | 2759 | 82.80% | 12.80% | 0.87% | 3.59% | NA |
| All Japonica | 1512 | 1.70% | 87.00% | 2.31% | 8.99% | NA |
| Aus | 269 | 32.00% | 66.20% | 0.37% | 1.49% | NA |
| Indica I | 595 | 65.90% | 25.90% | 2.18% | 6.05% | NA |
| Indica II | 465 | 90.80% | 5.80% | 1.08% | 2.37% | NA |
| Indica III | 913 | 96.40% | 1.60% | 0.00% | 1.97% | NA |
| Indica Intermediate | 786 | 75.10% | 19.80% | 0.76% | 4.33% | NA |
| Temperate Japonica | 767 | 2.10% | 86.70% | 0.39% | 10.82% | NA |
| Tropical Japonica | 504 | 1.00% | 88.30% | 5.16% | 5.56% | NA |
| Japonica Intermediate | 241 | 2.10% | 85.10% | 2.49% | 10.37% | NA |
| VI/Aromatic | 96 | 16.70% | 71.90% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 46.70% | 46.70% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709674724 | C -> DEL | N | N | silent_mutation | Average:28.49; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg0709674724 | C -> T | LOC_Os07g16510.1 | downstream_gene_variant ; 1401.0bp to feature; MODIFIER | silent_mutation | Average:28.49; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| vg0709674724 | C -> T | LOC_Os07g16500.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.49; most accessible tissue: Zhenshan97 flag leaf, score: 40.929 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709674724 | NA | 2.94E-07 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 3.62E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 2.42E-06 | mr1161 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 2.33E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 1.75E-06 | mr1442_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | 4.60E-06 | NA | mr1510_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 5.69E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 4.30E-08 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 1.21E-29 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 8.00E-07 | mr1624_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 6.05E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | NA | 4.11E-30 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709674724 | 4.77E-06 | 8.55E-09 | mr1980_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |