Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709674359:

Variant ID: vg0709674359 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9674359
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTGGGGTTATATATTGCGGATGAGAGGTGGGCCGCTTATGATGACAGCTCAGTATGGGTATTCCTCGACGCCGGTATATAATCCTAAGTTAATTCCCT[G/A]
GGGAGGGTATTCCTCCGTATTTAGCCCCGGTTGTATGGTCATGATGGGCTGTCATAAGGAATTCGGCAGTCAGGGGTGGCTTCTCGAAGTACCAGGAGGG

Reverse complement sequence

CCCTCCTGGTACTTCGAGAAGCCACCCCTGACTGCCGAATTCCTTATGACAGCCCATCATGACCATACAACCGGGGCTAAATACGGAGGAATACCCTCCC[C/T]
AGGGAATTAACTTAGGATTATATACCGGCGTCGAGGAATACCCATACTGAGCTGTCATCATAAGCGGCCCACCTCTCATCCGCAATATATAACCCCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	4.70%	2.07%	2.14%	NA
All Indica	2759	96.50%	0.20%	1.78%	1.52%	NA
All Japonica	1512	82.20%	11.40%	2.58%	3.84%	NA
Aus	269	94.10%	4.50%	1.49%	0.00%	NA
Indica I	595	94.50%	0.00%	2.69%	2.86%	NA
Indica II	465	97.00%	0.40%	1.51%	1.08%	NA
Indica III	913	98.50%	0.00%	0.99%	0.55%	NA
Indica Intermediate	786	95.50%	0.40%	2.16%	1.91%	NA
Temperate Japonica	767	82.90%	9.80%	1.30%	6.00%	NA
Tropical Japonica	504	88.70%	4.80%	4.37%	2.18%	NA
Japonica Intermediate	241	66.40%	30.30%	2.90%	0.41%	NA
VI/Aromatic	96	65.60%	29.20%	4.17%	1.04%	NA
Intermediate	90	90.00%	7.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709674359	G -> DEL	N	N	silent_mutation	Average:47.954; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0709674359	G -> A	LOC_Os07g16510.1	downstream_gene_variant ; 1766.0bp to feature; MODIFIER	silent_mutation	Average:47.954; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0709674359	G -> A	LOC_Os07g16500.1	intron_variant ; MODIFIER	silent_mutation	Average:47.954; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709674359	6.70E-07	NA	mr1117	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	2.48E-06	NA	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	4.24E-06	NA	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	5.31E-06	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	5.86E-07	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	3.60E-06	NA	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	NA	3.51E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	NA	7.39E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	NA	5.80E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	7.86E-06	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	8.12E-07	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	3.41E-08	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	4.18E-06	NA	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	4.20E-07	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	8.23E-07	NA	mr1118_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	9.30E-07	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	1.33E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	6.30E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	9.87E-06	NA	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	4.38E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	NA	6.14E-06	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	6.69E-08	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	7.82E-07	NA	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	9.74E-08	NA	mr1563_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709674359	NA	2.48E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251