\
| Variant ID: vg0709673627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9673627 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATCAATTCAGACGATAAATCAATTGGACGATGTCGAGTACCATACTTATGAATAGATGGGCCAAGAACTCAGAACTGGCACGATGACTTGGGCCAAAATT[C/T]
AGAAGTTTGCGGAGTGGAGCAATAGAGGAGGCCACCAGCCGAAATTGGGCTGGATTGGGCTAGCCCCAGGTTTGGCCGAACCTGGTGGTTCGGCCGAACC
GGTTCGGCCGAACCACCAGGTTCGGCCAAACCTGGGGCTAGCCCAATCCAGCCCAATTTCGGCTGGTGGCCTCCTCTATTGCTCCACTCCGCAAACTTCT[G/A]
AATTTTGGCCCAAGTCATCGTGCCAGTTCTGAGTTCTTGGCCCATCTATTCATAAGTATGGTACTCGACATCGTCCAATTGATTTATCGTCTGAATTGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 41.50% | 0.59% | 6.07% | NA |
| All Indica | 2759 | 82.70% | 12.80% | 0.36% | 4.13% | NA |
| All Japonica | 1512 | 1.70% | 87.10% | 0.99% | 10.25% | NA |
| Aus | 269 | 32.30% | 65.80% | 0.00% | 1.86% | NA |
| Indica I | 595 | 65.90% | 26.10% | 0.84% | 7.23% | NA |
| Indica II | 465 | 90.80% | 5.40% | 0.22% | 3.66% | NA |
| Indica III | 913 | 96.40% | 1.50% | 0.11% | 1.97% | NA |
| Indica Intermediate | 786 | 74.90% | 20.10% | 0.38% | 4.58% | NA |
| Temperate Japonica | 767 | 2.20% | 87.10% | 1.04% | 9.65% | NA |
| Tropical Japonica | 504 | 0.80% | 87.90% | 0.00% | 11.31% | NA |
| Japonica Intermediate | 241 | 1.70% | 85.50% | 2.90% | 9.96% | NA |
| VI/Aromatic | 96 | 16.70% | 72.90% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 44.40% | 48.90% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709673627 | C -> DEL | N | N | silent_mutation | Average:46.067; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0709673627 | C -> T | LOC_Os07g16510.1 | downstream_gene_variant ; 2498.0bp to feature; MODIFIER | silent_mutation | Average:46.067; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0709673627 | C -> T | LOC_Os07g16500.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.067; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709673627 | 4.10E-06 | 1.61E-08 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709673627 | NA | 7.91E-07 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709673627 | NA | 1.69E-07 | mr1161 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709673627 | NA | 3.59E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709673627 | 1.79E-06 | 8.29E-07 | mr1952_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |