\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709672762:

Variant ID: vg0709672762 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9672762
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCTCCATGGGAGGGGGACCCACCTAGCCTGGATCAGACCGCCATCCGTGCCTTCAACTAGAAGCAAGGTGGGGCCGAGCGCCGTCCTCCGCCTGACAC[A/G]
GGGGACGTTCCTGTCATTACCTCTTAAATGTATGGAGACTTTGGTGGACTCACCATGCGCAGGGGGCACACCTGGCATTGTGCTGATGGGACGGGGCATA

Reverse complement sequence

TATGCCCCGTCCCATCAGCACAATGCCAGGTGTGCCCCCTGCGCATGGTGAGTCCACCAAAGTCTCCATACATTTAAGAGGTAATGACAGGAACGTCCCC[T/C]
GTGTCAGGCGGAGGACGGCGCTCGGCCCCACCTTGCTTCTAGTTGAAGGCACGGATGGCGGTCTGATCCAGGCTAGGTGGGTCCCCCTCCCATGGAGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 41.00% 1.25% 5.40% NA
All Indica  2759 82.90% 12.70% 1.09% 3.33% NA
All Japonica  1512 1.60% 87.10% 1.52% 9.79% NA
Aus  269 32.30% 65.80% 0.74% 1.12% NA
Indica I  595 65.90% 26.10% 2.02% 6.05% NA
Indica II  465 90.30% 5.80% 0.43% 3.44% NA
Indica III  913 96.80% 1.30% 0.66% 1.20% NA
Indica Intermediate  786 75.20% 19.80% 1.27% 3.69% NA
Temperate Japonica  767 2.10% 86.80% 0.91% 10.17% NA
Tropical Japonica  504 0.80% 88.30% 2.78% 8.13% NA
Japonica Intermediate  241 1.70% 85.50% 0.83% 12.03% NA
VI/Aromatic  96 36.50% 52.10% 3.12% 8.33% NA
Intermediate  90 46.70% 47.80% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709672762 A -> DEL N N silent_mutation Average:79.377; most accessible tissue: Zhenshan97 flag leaf, score: 89.624 N N N N
vg0709672762 A -> G LOC_Os07g16500.1 upstream_gene_variant ; 502.0bp to feature; MODIFIER silent_mutation Average:79.377; most accessible tissue: Zhenshan97 flag leaf, score: 89.624 N N N N
vg0709672762 A -> G LOC_Os07g16510.1 downstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:79.377; most accessible tissue: Zhenshan97 flag leaf, score: 89.624 N N N N
vg0709672762 A -> G LOC_Os07g16490-LOC_Os07g16500 intergenic_region ; MODIFIER silent_mutation Average:79.377; most accessible tissue: Zhenshan97 flag leaf, score: 89.624 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0709672762 A G -0.01 -0.01 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709672762 1.77E-06 2.51E-08 mr1026 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672762 NA 1.11E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672762 2.85E-06 1.11E-07 mr1161 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672762 7.08E-06 9.61E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672762 NA 8.50E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251