\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709672527:

Variant ID: vg0709672527 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9672527
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGAATCTGCGTGAGAGATGAGGAATTATACAGGTTCGGGCCACCTGGGATGCGTAACACCCTACTCCTGTGCGTGGAATTATTGTGGAGTTCTTATAAG[A/C,T]
GATCTTGAGTTCTGCGGAAACCCTAGCTGTTCTTCCTATAGAGCTCAAGCTATCAAGAGTCGTCCCCTTTTTTTCGATGGTGAAGGTCCTCCTTTCATAG

Reverse complement sequence

CTATGAAAGGAGGACCTTCACCATCGAAAAAAAGGGGACGACTCTTGATAGCTTGAGCTCTATAGGAAGAACAGCTAGGGTTTCCGCAGAACTCAAGATC[T/G,A]
CTTATAAGAACTCCACAATAATTCCACGCACAGGAGTAGGGTGTTACGCATCCCAGGTGGCCCGAACCTGTATAATTCCTCATCTCTCACGCAGATTCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 41.10% 0.80% 5.76% T: 0.51%
All Indica  2759 82.70% 12.80% 0.43% 3.95% T: 0.14%
All Japonica  1512 1.60% 87.30% 1.65% 9.46% NA
Aus  269 32.30% 65.80% 0.00% 1.86% NA
Indica I  595 65.90% 26.40% 1.34% 6.39% NA
Indica II  465 90.50% 5.60% 0.22% 3.66% NA
Indica III  913 96.40% 1.10% 0.00% 2.08% T: 0.44%
Indica Intermediate  786 74.90% 20.20% 0.38% 4.45% NA
Temperate Japonica  767 2.10% 87.20% 1.30% 9.39% NA
Tropical Japonica  504 0.80% 88.10% 0.20% 10.91% NA
Japonica Intermediate  241 1.70% 85.90% 5.81% 6.64% NA
VI/Aromatic  96 16.70% 52.10% 1.04% 10.42% T: 19.79%
Intermediate  90 44.40% 48.90% 0.00% 5.56% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709672527 A -> DEL N N silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0709672527 A -> T LOC_Os07g16500.1 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0709672527 A -> T LOC_Os07g16510.1 downstream_gene_variant ; 3598.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0709672527 A -> T LOC_Os07g16490-LOC_Os07g16500 intergenic_region ; MODIFIER silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0709672527 A -> C LOC_Os07g16500.1 upstream_gene_variant ; 737.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0709672527 A -> C LOC_Os07g16510.1 downstream_gene_variant ; 3598.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N
vg0709672527 A -> C LOC_Os07g16490-LOC_Os07g16500 intergenic_region ; MODIFIER silent_mutation Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709672527 9.04E-06 7.24E-08 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 1.27E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 6.63E-07 mr1161 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 2.65E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 6.67E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 2.02E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 2.01E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 NA 3.95E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 6.62E-06 NA mr1882_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709672527 2.38E-06 8.11E-07 mr1952_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251