\
| Variant ID: vg0709672527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9672527 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCGAATCTGCGTGAGAGATGAGGAATTATACAGGTTCGGGCCACCTGGGATGCGTAACACCCTACTCCTGTGCGTGGAATTATTGTGGAGTTCTTATAAG[A/C,T]
GATCTTGAGTTCTGCGGAAACCCTAGCTGTTCTTCCTATAGAGCTCAAGCTATCAAGAGTCGTCCCCTTTTTTTCGATGGTGAAGGTCCTCCTTTCATAG
CTATGAAAGGAGGACCTTCACCATCGAAAAAAAGGGGACGACTCTTGATAGCTTGAGCTCTATAGGAAGAACAGCTAGGGTTTCCGCAGAACTCAAGATC[T/G,A]
CTTATAAGAACTCCACAATAATTCCACGCACAGGAGTAGGGTGTTACGCATCCCAGGTGGCCCGAACCTGTATAATTCCTCATCTCTCACGCAGATTCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.80% | 41.10% | 0.80% | 5.76% | T: 0.51% |
| All Indica | 2759 | 82.70% | 12.80% | 0.43% | 3.95% | T: 0.14% |
| All Japonica | 1512 | 1.60% | 87.30% | 1.65% | 9.46% | NA |
| Aus | 269 | 32.30% | 65.80% | 0.00% | 1.86% | NA |
| Indica I | 595 | 65.90% | 26.40% | 1.34% | 6.39% | NA |
| Indica II | 465 | 90.50% | 5.60% | 0.22% | 3.66% | NA |
| Indica III | 913 | 96.40% | 1.10% | 0.00% | 2.08% | T: 0.44% |
| Indica Intermediate | 786 | 74.90% | 20.20% | 0.38% | 4.45% | NA |
| Temperate Japonica | 767 | 2.10% | 87.20% | 1.30% | 9.39% | NA |
| Tropical Japonica | 504 | 0.80% | 88.10% | 0.20% | 10.91% | NA |
| Japonica Intermediate | 241 | 1.70% | 85.90% | 5.81% | 6.64% | NA |
| VI/Aromatic | 96 | 16.70% | 52.10% | 1.04% | 10.42% | T: 19.79% |
| Intermediate | 90 | 44.40% | 48.90% | 0.00% | 5.56% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709672527 | A -> DEL | N | N | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0709672527 | A -> T | LOC_Os07g16500.1 | upstream_gene_variant ; 737.0bp to feature; MODIFIER | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0709672527 | A -> T | LOC_Os07g16510.1 | downstream_gene_variant ; 3598.0bp to feature; MODIFIER | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0709672527 | A -> T | LOC_Os07g16490-LOC_Os07g16500 | intergenic_region ; MODIFIER | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0709672527 | A -> C | LOC_Os07g16500.1 | upstream_gene_variant ; 737.0bp to feature; MODIFIER | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0709672527 | A -> C | LOC_Os07g16510.1 | downstream_gene_variant ; 3598.0bp to feature; MODIFIER | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| vg0709672527 | A -> C | LOC_Os07g16490-LOC_Os07g16500 | intergenic_region ; MODIFIER | silent_mutation | Average:68.439; most accessible tissue: Zhenshan97 young leaf, score: 85.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709672527 | 9.04E-06 | 7.24E-08 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 1.27E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 6.63E-07 | mr1161 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 2.65E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 6.67E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 2.02E-29 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 2.01E-06 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | NA | 3.95E-29 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | 6.62E-06 | NA | mr1882_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709672527 | 2.38E-06 | 8.11E-07 | mr1952_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |