\
| Variant ID: vg0709622923 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9622923 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGCGCAGAAATACTTCTGGTATTTTATGGTTATAGAGTTCATCCACAAGCGACGGATATACCATTGTAACATTTCACCCGAGAGTATTCCAAGGGTATC[G/A]
TATTTATTTTATCCCGTGGGAAGATCATGTAGAGAGAACTTGACTAATAATTTATATATTAGTTGTGATAATCATATTCTAAGCAGGGGTTAAGATAATC
GATTATCTTAACCCCTGCTTAGAATATGATTATCACAACTAATATATAAATTATTAGTCAAGTTCTCTCTACATGATCTTCCCACGGGATAAAATAAATA[C/T]
GATACCCTTGGAATACTCTCGGGTGAAATGTTACAATGGTATATCCGTCGCTTGTGGATGAACTCTATAACCATAAAATACCAGAAGTATTTCTGCGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.00% | 4.40% | 7.85% | 43.74% | NA |
| All Indica | 2759 | 25.70% | 0.30% | 8.81% | 65.20% | NA |
| All Japonica | 1512 | 74.00% | 10.20% | 7.01% | 8.80% | NA |
| Aus | 269 | 68.80% | 4.10% | 4.09% | 23.05% | NA |
| Indica I | 595 | 35.10% | 0.00% | 9.92% | 54.96% | NA |
| Indica II | 465 | 27.70% | 0.40% | 9.68% | 62.15% | NA |
| Indica III | 913 | 13.30% | 0.10% | 7.56% | 79.08% | NA |
| Indica Intermediate | 786 | 31.90% | 0.50% | 8.91% | 58.65% | NA |
| Temperate Japonica | 767 | 75.60% | 8.00% | 8.34% | 8.08% | NA |
| Tropical Japonica | 504 | 84.10% | 4.80% | 7.74% | 3.37% | NA |
| Japonica Intermediate | 241 | 47.70% | 28.60% | 1.24% | 22.41% | NA |
| VI/Aromatic | 96 | 24.00% | 28.10% | 5.21% | 42.71% | NA |
| Intermediate | 90 | 48.90% | 8.90% | 6.67% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709622923 | G -> DEL | N | N | silent_mutation | Average:10.626; most accessible tissue: Callus, score: 20.555 | N | N | N | N |
| vg0709622923 | G -> A | LOC_Os07g16420.1 | downstream_gene_variant ; 709.0bp to feature; MODIFIER | silent_mutation | Average:10.626; most accessible tissue: Callus, score: 20.555 | N | N | N | N |
| vg0709622923 | G -> A | LOC_Os07g16430.1 | downstream_gene_variant ; 1410.0bp to feature; MODIFIER | silent_mutation | Average:10.626; most accessible tissue: Callus, score: 20.555 | N | N | N | N |
| vg0709622923 | G -> A | LOC_Os07g16420-LOC_Os07g16430 | intergenic_region ; MODIFIER | silent_mutation | Average:10.626; most accessible tissue: Callus, score: 20.555 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709622923 | NA | 9.85E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709622923 | 1.22E-06 | NA | mr1350_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709622923 | 3.24E-06 | 3.15E-08 | mr1865_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |