Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709616672:

Variant ID: vg0709616672 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9616672
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTTAGATCTGCAATTTGAATGCAAAGAAGAGTTCGTTCCTTTCCCGTATGAGTCTAATTTCATCTAATAATACACCTATATCAAATTATTATCAATCC[G/A]
TTATATATTCTCACCGTATTGTGCATTGGACCTTTTCGGCTAATTAATTTATATTTCTATATGTATTGACCCTGTTTAATTCAGAACTCAACATTTACCT

Reverse complement sequence

AGGTAAATGTTGAGTTCTGAATTAAACAGGGTCAATACATATAGAAATATAAATTAATTAGCCGAAAAGGTCCAATGCACAATACGGTGAGAATATATAA[C/T]
GGATTGATAATAATTTGATATAGGTGTATTATTAGATGAAATTAGACTCATACGGGAAAGGAACGAACTCTTCTTTGCATTCAAATTGCAGATCTAACGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.20%	4.00%	0.83%	50.00%	NA
All Indica	2759	27.90%	0.20%	0.65%	71.26%	NA
All Japonica	1512	74.20%	8.90%	1.26%	15.61%	NA
Aus	269	63.90%	4.50%	0.00%	31.60%	NA
Indica I	595	56.80%	0.00%	0.84%	42.35%	NA
Indica II	465	25.20%	0.20%	1.29%	73.33%	NA
Indica III	913	3.00%	0.10%	0.11%	96.82%	NA
Indica Intermediate	786	36.60%	0.40%	0.76%	62.21%	NA
Temperate Japonica	767	76.10%	6.10%	1.56%	16.17%	NA
Tropical Japonica	504	83.50%	4.20%	0.60%	11.71%	NA
Japonica Intermediate	241	48.50%	27.80%	1.66%	21.99%	NA
VI/Aromatic	96	29.20%	30.20%	0.00%	40.62%	NA
Intermediate	90	50.00%	6.70%	2.22%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709616672	G -> DEL	N	N	silent_mutation	Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0709616672	G -> A	LOC_Os07g16420.1	upstream_gene_variant ; 174.0bp to feature; MODIFIER	silent_mutation	Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0709616672	G -> A	LOC_Os07g16410.1	downstream_gene_variant ; 952.0bp to feature; MODIFIER	silent_mutation	Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N
vg0709616672	G -> A	LOC_Os07g16410-LOC_Os07g16420	intergenic_region ; MODIFIER	silent_mutation	Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709616672	NA	2.14E-07	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	7.25E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	4.32E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	3.66E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	1.09E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	1.61E-07	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	9.93E-07	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	7.92E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	7.70E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	7.63E-09	mr1510_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	8.97E-07	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672	NA	5.91E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251