\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709616672:

Variant ID: vg0709616672 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9616672
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTTAGATCTGCAATTTGAATGCAAAGAAGAGTTCGTTCCTTTCCCGTATGAGTCTAATTTCATCTAATAATACACCTATATCAAATTATTATCAATCC[G/A]
TTATATATTCTCACCGTATTGTGCATTGGACCTTTTCGGCTAATTAATTTATATTTCTATATGTATTGACCCTGTTTAATTCAGAACTCAACATTTACCT

Reverse complement sequence

AGGTAAATGTTGAGTTCTGAATTAAACAGGGTCAATACATATAGAAATATAAATTAATTAGCCGAAAAGGTCCAATGCACAATACGGTGAGAATATATAA[C/T]
GGATTGATAATAATTTGATATAGGTGTATTATTAGATGAAATTAGACTCATACGGGAAAGGAACGAACTCTTCTTTGCATTCAAATTGCAGATCTAACGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.20% 4.00% 0.83% 50.00% NA
All Indica  2759 27.90% 0.20% 0.65% 71.26% NA
All Japonica  1512 74.20% 8.90% 1.26% 15.61% NA
Aus  269 63.90% 4.50% 0.00% 31.60% NA
Indica I  595 56.80% 0.00% 0.84% 42.35% NA
Indica II  465 25.20% 0.20% 1.29% 73.33% NA
Indica III  913 3.00% 0.10% 0.11% 96.82% NA
Indica Intermediate  786 36.60% 0.40% 0.76% 62.21% NA
Temperate Japonica  767 76.10% 6.10% 1.56% 16.17% NA
Tropical Japonica  504 83.50% 4.20% 0.60% 11.71% NA
Japonica Intermediate  241 48.50% 27.80% 1.66% 21.99% NA
VI/Aromatic  96 29.20% 30.20% 0.00% 40.62% NA
Intermediate  90 50.00% 6.70% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709616672 G -> DEL N N silent_mutation Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0709616672 G -> A LOC_Os07g16420.1 upstream_gene_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0709616672 G -> A LOC_Os07g16410.1 downstream_gene_variant ; 952.0bp to feature; MODIFIER silent_mutation Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N
vg0709616672 G -> A LOC_Os07g16410-LOC_Os07g16420 intergenic_region ; MODIFIER silent_mutation Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709616672 NA 2.14E-07 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 7.25E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 4.32E-06 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 3.66E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 1.09E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 1.61E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 9.93E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 7.92E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 7.70E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 7.63E-09 mr1510_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 8.97E-07 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709616672 NA 5.91E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251