\
| Variant ID: vg0709616672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9616672 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACGTTAGATCTGCAATTTGAATGCAAAGAAGAGTTCGTTCCTTTCCCGTATGAGTCTAATTTCATCTAATAATACACCTATATCAAATTATTATCAATCC[G/A]
TTATATATTCTCACCGTATTGTGCATTGGACCTTTTCGGCTAATTAATTTATATTTCTATATGTATTGACCCTGTTTAATTCAGAACTCAACATTTACCT
AGGTAAATGTTGAGTTCTGAATTAAACAGGGTCAATACATATAGAAATATAAATTAATTAGCCGAAAAGGTCCAATGCACAATACGGTGAGAATATATAA[C/T]
GGATTGATAATAATTTGATATAGGTGTATTATTAGATGAAATTAGACTCATACGGGAAAGGAACGAACTCTTCTTTGCATTCAAATTGCAGATCTAACGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.20% | 4.00% | 0.83% | 50.00% | NA |
| All Indica | 2759 | 27.90% | 0.20% | 0.65% | 71.26% | NA |
| All Japonica | 1512 | 74.20% | 8.90% | 1.26% | 15.61% | NA |
| Aus | 269 | 63.90% | 4.50% | 0.00% | 31.60% | NA |
| Indica I | 595 | 56.80% | 0.00% | 0.84% | 42.35% | NA |
| Indica II | 465 | 25.20% | 0.20% | 1.29% | 73.33% | NA |
| Indica III | 913 | 3.00% | 0.10% | 0.11% | 96.82% | NA |
| Indica Intermediate | 786 | 36.60% | 0.40% | 0.76% | 62.21% | NA |
| Temperate Japonica | 767 | 76.10% | 6.10% | 1.56% | 16.17% | NA |
| Tropical Japonica | 504 | 83.50% | 4.20% | 0.60% | 11.71% | NA |
| Japonica Intermediate | 241 | 48.50% | 27.80% | 1.66% | 21.99% | NA |
| VI/Aromatic | 96 | 29.20% | 30.20% | 0.00% | 40.62% | NA |
| Intermediate | 90 | 50.00% | 6.70% | 2.22% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709616672 | G -> DEL | N | N | silent_mutation | Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| vg0709616672 | G -> A | LOC_Os07g16420.1 | upstream_gene_variant ; 174.0bp to feature; MODIFIER | silent_mutation | Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| vg0709616672 | G -> A | LOC_Os07g16410.1 | downstream_gene_variant ; 952.0bp to feature; MODIFIER | silent_mutation | Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| vg0709616672 | G -> A | LOC_Os07g16410-LOC_Os07g16420 | intergenic_region ; MODIFIER | silent_mutation | Average:6.028; most accessible tissue: Zhenshan97 flower, score: 11.396 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709616672 | NA | 2.14E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 7.25E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 4.32E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 3.66E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 1.09E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 1.61E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 9.93E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 7.92E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 7.70E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 7.63E-09 | mr1510_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 8.97E-07 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709616672 | NA | 5.91E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |