\
| Variant ID: vg0709590699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9590699 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 94. )
CACAACAGTAGCTCGCGAACTGGTCATTAATTGCCATGAGCACGACCTTCAAAACCATGTGCTCACAACCCACCATTAATCATATTTTAGTTACCAATTA[G/A]
TTATCATAACACGATTAACCATCGTGAGCTACCATTAAATATAACCATAAATAATAATGTAATATATATGATTCATCCCATTAGTGAGCTAATGTTTCTA
TAGAAACATTAGCTCACTAATGGGATGAATCATATATATTACATTATTATTTATGGTTATATTTAATGGTAGCTCACGATGGTTAATCGTGTTATGATAA[C/T]
TAATTGGTAACTAAAATATGATTAATGGTGGGTTGTGAGCACATGGTTTTGAAGGTCGTGCTCATGGCAATTAATGACCAGTTCGCGAGCTACTGTTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 1.50% | 20.12% | 46.93% | NA |
| All Indica | 2759 | 6.80% | 2.40% | 26.39% | 64.44% | NA |
| All Japonica | 1512 | 68.00% | 0.10% | 7.54% | 24.40% | NA |
| Aus | 269 | 68.00% | 1.50% | 18.96% | 11.52% | NA |
| Indica I | 595 | 7.10% | 1.00% | 35.80% | 56.13% | NA |
| Indica II | 465 | 6.00% | 0.90% | 18.92% | 74.19% | NA |
| Indica III | 913 | 1.40% | 4.70% | 24.53% | 69.33% | NA |
| Indica Intermediate | 786 | 13.20% | 1.70% | 25.83% | 59.29% | NA |
| Temperate Japonica | 767 | 60.10% | 0.10% | 2.87% | 36.90% | NA |
| Tropical Japonica | 504 | 86.90% | 0.00% | 11.71% | 1.39% | NA |
| Japonica Intermediate | 241 | 53.50% | 0.00% | 13.69% | 32.78% | NA |
| VI/Aromatic | 96 | 49.00% | 0.00% | 40.62% | 10.42% | NA |
| Intermediate | 90 | 45.60% | 0.00% | 21.11% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709590699 | G -> DEL | N | N | silent_mutation | Average:48.381; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0709590699 | G -> A | LOC_Os07g16400.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.381; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709590699 | NA | 1.13E-15 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | NA | 2.45E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | NA | 3.70E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | NA | 5.65E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | 4.99E-07 | 4.99E-07 | mr1953 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | NA | 8.01E-30 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | NA | 9.97E-10 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709590699 | NA | 2.11E-30 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |