\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709588264:

Variant ID: vg0709588264 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9588264
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATTATTAAGCAACAACAACAAATAACAAAGTTTATTAAAAAGAAAAACTAAAAATAAACCCTCTCCTCCCTTTGGGCCAAGTCCAGCCCAAAGCCTC[C/T,G]
CTCTCTCTCCCTCGGCCCGCGGCCGAAGTCCTTCCCTCCTCCCTCTCTTTTTTCTTCCGGAATAAGTTCACTTTGGGTCCCTCTATTTGTCGCCCAGTCC

Reverse complement sequence

GGACTGGGCGACAAATAGAGGGACCCAAAGTGAACTTATTCCGGAAGAAAAAAGAGAGGGAGGAGGGAAGGACTTCGGCCGCGGGCCGAGGGAGAGAGAG[G/A,C]
GAGGCTTTGGGCTGGACTTGGCCCAAAGGGAGGAGAGGGTTTATTTTTAGTTTTTCTTTTTAATAAACTTTGTTATTTGTTGTTGTTGCTTAATAATTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 45.40% 0.38% 4.13% G: 1.50%
All Indica  2759 79.30% 20.40% 0.11% 0.18% NA
All Japonica  1512 1.20% 84.10% 0.66% 10.12% G: 3.90%
Aus  269 14.10% 81.40% 0.74% 3.72% NA
Indica I  595 64.50% 35.30% 0.17% 0.00% NA
Indica II  465 89.00% 10.30% 0.22% 0.43% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 70.60% 28.90% 0.13% 0.38% NA
Temperate Japonica  767 1.40% 89.60% 0.65% 8.21% G: 0.13%
Tropical Japonica  504 0.80% 83.70% 0.00% 4.37% G: 11.11%
Japonica Intermediate  241 1.20% 67.60% 2.07% 28.22% G: 0.83%
VI/Aromatic  96 15.60% 55.20% 1.04% 21.88% G: 6.25%
Intermediate  90 41.10% 43.30% 2.22% 6.67% G: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709588264 C -> DEL N N silent_mutation Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0709588264 C -> G LOC_Os07g16400.1 upstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0709588264 C -> G LOC_Os07g16380-LOC_Os07g16400 intergenic_region ; MODIFIER silent_mutation Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0709588264 C -> T LOC_Os07g16400.1 upstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N
vg0709588264 C -> T LOC_Os07g16380-LOC_Os07g16400 intergenic_region ; MODIFIER silent_mutation Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709588264 NA 1.07E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 NA 2.99E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 2.29E-06 2.91E-17 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 3.69E-07 3.69E-07 mr1270 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 NA 6.49E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 NA 6.87E-06 mr1468 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 NA 1.07E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709588264 NA 1.95E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251