\
| Variant ID: vg0709588264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9588264 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATAATTATTAAGCAACAACAACAAATAACAAAGTTTATTAAAAAGAAAAACTAAAAATAAACCCTCTCCTCCCTTTGGGCCAAGTCCAGCCCAAAGCCTC[C/T,G]
CTCTCTCTCCCTCGGCCCGCGGCCGAAGTCCTTCCCTCCTCCCTCTCTTTTTTCTTCCGGAATAAGTTCACTTTGGGTCCCTCTATTTGTCGCCCAGTCC
GGACTGGGCGACAAATAGAGGGACCCAAAGTGAACTTATTCCGGAAGAAAAAAGAGAGGGAGGAGGGAAGGACTTCGGCCGCGGGCCGAGGGAGAGAGAG[G/A,C]
GAGGCTTTGGGCTGGACTTGGCCCAAAGGGAGGAGAGGGTTTATTTTTAGTTTTTCTTTTTAATAAACTTTGTTATTTGTTGTTGTTGCTTAATAATTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.60% | 45.40% | 0.38% | 4.13% | G: 1.50% |
| All Indica | 2759 | 79.30% | 20.40% | 0.11% | 0.18% | NA |
| All Japonica | 1512 | 1.20% | 84.10% | 0.66% | 10.12% | G: 3.90% |
| Aus | 269 | 14.10% | 81.40% | 0.74% | 3.72% | NA |
| Indica I | 595 | 64.50% | 35.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 89.00% | 10.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 70.60% | 28.90% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 1.40% | 89.60% | 0.65% | 8.21% | G: 0.13% |
| Tropical Japonica | 504 | 0.80% | 83.70% | 0.00% | 4.37% | G: 11.11% |
| Japonica Intermediate | 241 | 1.20% | 67.60% | 2.07% | 28.22% | G: 0.83% |
| VI/Aromatic | 96 | 15.60% | 55.20% | 1.04% | 21.88% | G: 6.25% |
| Intermediate | 90 | 41.10% | 43.30% | 2.22% | 6.67% | G: 6.67% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709588264 | C -> DEL | N | N | silent_mutation | Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| vg0709588264 | C -> G | LOC_Os07g16400.1 | upstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| vg0709588264 | C -> G | LOC_Os07g16380-LOC_Os07g16400 | intergenic_region ; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| vg0709588264 | C -> T | LOC_Os07g16400.1 | upstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| vg0709588264 | C -> T | LOC_Os07g16380-LOC_Os07g16400 | intergenic_region ; MODIFIER | silent_mutation | Average:42.935; most accessible tissue: Zhenshan97 root, score: 66.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709588264 | NA | 1.07E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | NA | 2.99E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | 2.29E-06 | 2.91E-17 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | 3.69E-07 | 3.69E-07 | mr1270 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | NA | 6.49E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | NA | 6.87E-06 | mr1468 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | NA | 1.07E-09 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709588264 | NA | 1.95E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |