\
| Variant ID: vg0709483572 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9483572 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATCGTTATATGCATTGAGGCGTAAGGTGTCAGAAGCAACACTTCGACCTTAGGTTTGGGTTTTGTCGGACTTTACAACCAACGGTTCGACGTCGGGTCA[G/A]
AAGACCGTGCGAACGTCCCCATGGAAGGCGTAAAGTTCCAAACGGTGGTTGTTTAGTGGCAAAGGGTATTTTTGGGTAAAAAGAAAATATTTGAAAGGCA
TGCCTTTCAAATATTTTCTTTTTACCCAAAAATACCCTTTGCCACTAAACAACCACCGTTTGGAACTTTACGCCTTCCATGGGGACGTTCGCACGGTCTT[C/T]
TGACCCGACGTCGAACCGTTGGTTGTAAAGTCCGACAAAACCCAAACCTAAGGTCGAAGTGTTGCTTCTGACACCTTACGCCTCAATGCATATAACGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.60% | 6.80% | 2.50% | 2.09% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 75.90% | 10.10% | 7.47% | 6.48% | NA |
| Aus | 269 | 43.90% | 55.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 31.50% | 28.20% | 21.43% | 18.85% | NA |
| Japonica Intermediate | 241 | 92.90% | 4.60% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709483572 | G -> DEL | N | N | silent_mutation | Average:32.995; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| vg0709483572 | G -> A | LOC_Os07g16240.1 | downstream_gene_variant ; 4646.0bp to feature; MODIFIER | silent_mutation | Average:32.995; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| vg0709483572 | G -> A | LOC_Os07g16250.1 | downstream_gene_variant ; 2587.0bp to feature; MODIFIER | silent_mutation | Average:32.995; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| vg0709483572 | G -> A | LOC_Os07g16240-LOC_Os07g16250 | intergenic_region ; MODIFIER | silent_mutation | Average:32.995; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709483572 | NA | 8.30E-17 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 4.29E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 3.25E-07 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 7.36E-08 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 9.41E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 7.88E-08 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 4.33E-06 | mr1319_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | 1.25E-06 | 1.25E-06 | mr1335_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 2.19E-15 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 8.75E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 9.59E-09 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 3.34E-07 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 4.41E-10 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 3.95E-11 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 3.20E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709483572 | NA | 6.69E-08 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |