\
| Variant ID: vg0709453116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9453116 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 72. )
GTGAATTATTTGTATTATTATTTTATTGATGGAAGCTTTACTTTAATTATGAACATATTTTACTTGCCATTATAAATTATAAAAGGGCTAATAATTATCC[C/A]
TGCTCTATATGTTACACTTGTGAGGCTAATAATATTATAGTTACAGATTATCTCATCACATAATTTTACAATGAATAATCTTAATTTACAATTGAACTTA
TAAGTTCAATTGTAAATTAAGATTATTCATTGTAAAATTATGTGATGAGATAATCTGTAACTATAATATTATTAGCCTCACAAGTGTAACATATAGAGCA[G/T]
GGATAATTATTAGCCCTTTTATAATTTATAATGGCAAGTAAAATATGTTCATAATTAAAGTAAAGCTTCCATCAATAAAATAATAATACAAATAATTCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.80% | 1.00% | 15.51% | 50.74% | NA |
| All Indica | 2759 | 2.70% | 1.60% | 16.24% | 79.52% | NA |
| All Japonica | 1512 | 83.20% | 0.10% | 9.33% | 7.41% | NA |
| Aus | 269 | 61.70% | 0.40% | 24.54% | 13.38% | NA |
| Indica I | 595 | 2.50% | 1.00% | 12.61% | 83.87% | NA |
| Indica II | 465 | 3.90% | 3.20% | 13.98% | 78.92% | NA |
| Indica III | 913 | 0.70% | 1.60% | 15.12% | 82.58% | NA |
| Indica Intermediate | 786 | 4.50% | 0.90% | 21.63% | 73.03% | NA |
| Temperate Japonica | 767 | 88.10% | 0.00% | 1.69% | 10.17% | NA |
| Tropical Japonica | 504 | 83.50% | 0.00% | 14.88% | 1.59% | NA |
| Japonica Intermediate | 241 | 66.80% | 0.40% | 21.99% | 10.79% | NA |
| VI/Aromatic | 96 | 19.80% | 1.00% | 62.50% | 16.67% | NA |
| Intermediate | 90 | 35.60% | 0.00% | 20.00% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709453116 | C -> DEL | N | N | silent_mutation | Average:18.346; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 | N | N | N | N |
| vg0709453116 | C -> A | LOC_Os07g16210.1 | upstream_gene_variant ; 1824.0bp to feature; MODIFIER | silent_mutation | Average:18.346; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 | N | N | N | N |
| vg0709453116 | C -> A | LOC_Os07g16190-LOC_Os07g16210 | intergenic_region ; MODIFIER | silent_mutation | Average:18.346; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709453116 | NA | 1.91E-22 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 4.71E-06 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 1.03E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 7.94E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 8.87E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 1.80E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 7.62E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 4.51E-10 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 6.11E-23 | mr1416 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 1.77E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 3.36E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 8.67E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 9.62E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 4.06E-06 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 1.29E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 7.87E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 3.04E-07 | NA | mr1113_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 2.73E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 1.29E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 2.38E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 4.21E-08 | NA | mr1120_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 1.65E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 2.21E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 1.20E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 2.44E-07 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | 9.61E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 1.87E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 5.44E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 7.72E-07 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709453116 | NA | 3.75E-06 | mr1872_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |