Variant ID: vg0709448532 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 9448532 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACCACAAGCGGGAGTGGGTAACTGCTTGATCTGAAGTATAGCTCGACCCTTTCCTAGGCACCGGTGGCGAGGGTGGGCGTGATGGAGTTGGGTCGGCC[G/A]
GGGTGTCCGGTTGTCCAGCTGCCGGATTCACCGCGGTGCAAGAGGGGACCGCCCACTGCCTTTTGAGGGGTGGGGGTGAAACCTTAGCGTGGTGTGGATG
CATCCACACCACGCTAAGGTTTCACCCCCACCCCTCAAAAGGCAGTGGGCGGTCCCCTCTTGCACCGCGGTGAATCCGGCAGCTGGACAACCGGACACCC[C/T]
GGCCGACCCAACTCCATCACGCCCACCCTCGCCACCGGTGCCTAGGAAAGGGTCGAGCTATACTTCAGATCAAGCAGTTACCCACTCCCGCTTGTGGTAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.30% | 2.30% | 1.40% | 0.00% | NA |
All Indica | 2759 | 93.70% | 3.90% | 2.36% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 81.50% | 12.10% | 6.39% | 0.00% | NA |
Indica II | 465 | 97.80% | 0.60% | 1.51% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.30% | 4.20% | 2.54% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0709448532 | G -> A | LOC_Os07g16190-LOC_Os07g16210 | intergenic_region ; MODIFIER | silent_mutation | Average:41.157; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0709448532 | NA | 3.08E-11 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0709448532 | NA | 6.66E-07 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0709448532 | NA | 1.52E-07 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | NA | 1.64E-06 | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | NA | 2.03E-06 | mr1363 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | NA | 5.73E-06 | mr1448 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | 8.38E-06 | 8.37E-06 | mr1527 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | NA | 5.69E-06 | mr1532 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | NA | 6.10E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709448532 | NA | 2.84E-08 | mr1156_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/