Variant ID: vg0709436324 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 9436324 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 209. )
ATCGGTTAGATCGCCGGTTTGCTCGTTACGGAACCCCAACTTATCATTTGTGTTCCATTCCTATTTGCAATTCAGATTGCTTTTATCTTGTTCTTACTTG[A/G]
CAGTTGAGCTCATTGGTCCACATACATCAGTATGTACTAGTGCCAATAGTTCACTTGCCCTTTCACTTTGACCCGTGAAAGGTGCCTTTGTCATCTTGCC
GGCAAGATGACAAAGGCACCTTTCACGGGTCAAAGTGAAAGGGCAAGTGAACTATTGGCACTAGTACATACTGATGTATGTGGACCAATGAGCTCAACTG[T/C]
CAAGTAAGAACAAGATAAAAGCAATCTGAATTGCAAATAGGAATGGAACACAAATGATAAGTTGGGGTTCCGTAACGAGCAAACCGGCGATCTAACCGAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 68.10% | 30.50% | 0.11% | 1.25% | NA |
All Indica | 2759 | 98.30% | 1.60% | 0.00% | 0.11% | NA |
All Japonica | 1512 | 17.20% | 78.80% | 0.33% | 3.70% | NA |
Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.20% | 0.50% | 0.00% | 0.34% | NA |
Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.90% | 2.90% | 0.00% | 0.13% | NA |
Temperate Japonica | 767 | 12.10% | 79.90% | 0.65% | 7.30% | NA |
Tropical Japonica | 504 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0709436324 | A -> DEL | LOC_Os07g16190.1 | N | frameshift_variant | Average:27.674; most accessible tissue: Minghui63 flag leaf, score: 38.911 | N | N | N | N |
vg0709436324 | A -> G | LOC_Os07g16190.1 | missense_variant ; p.Val376Ala; MODERATE | nonsynonymous_codon ; V376A | Average:27.674; most accessible tissue: Minghui63 flag leaf, score: 38.911 | unknown | unknown | TOLERATED | 1.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0709436324 | NA | 1.70E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 9.09E-23 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 1.87E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | 5.32E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 4.48E-21 | mr1131 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 4.42E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 1.34E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 4.47E-11 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | 6.77E-06 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709436324 | NA | 1.33E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/