\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709372324:

Variant ID: vg0709372324 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9372324
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTATGACTTTGTAAGAAATGCTTGTGAAATAGAAAAGAAATCTATCTAACTAAGTTTTCTTACTCTGGGTATGTCGTGTATGAGCGTTTTCTCACTT[T/G]
GCGACTTCGATCAGTCACTAGAGCTATACGCTCTCCATAGCTCCCAGCCTTGTAGTCAGAGAATCGTTCTCGGAGGACAAGGCTCTTGGACCCTTGACCT

Reverse complement sequence

AGGTCAAGGGTCCAAGAGCCTTGTCCTCCGAGAACGATTCTCTGACTACAAGGCTGGGAGCTATGGAGAGCGTATAGCTCTAGTGACTGATCGAAGTCGC[A/C]
AAGTGAGAAAACGCTCATACACGACATACCCAGAGTAAGAAAACTTAGTTAGATAGATTTCTTTTCTATTTCACAAGCATTTCTTACAAAGTCATAAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 3.50% 2.58% 44.75% NA
All Indica  2759 23.10% 0.60% 3.37% 73.00% NA
All Japonica  1512 98.50% 0.50% 0.13% 0.93% NA
Aus  269 29.70% 53.20% 5.58% 11.52% NA
Indica I  595 38.80% 0.20% 2.86% 58.15% NA
Indica II  465 13.10% 0.20% 3.66% 83.01% NA
Indica III  913 11.20% 0.10% 3.40% 85.32% NA
Indica Intermediate  786 30.80% 1.70% 3.56% 63.99% NA
Temperate Japonica  767 98.70% 0.00% 0.13% 1.17% NA
Tropical Japonica  504 99.00% 0.20% 0.00% 0.79% NA
Japonica Intermediate  241 96.70% 2.50% 0.41% 0.41% NA
VI/Aromatic  96 68.80% 0.00% 9.38% 21.88% NA
Intermediate  90 56.70% 1.10% 3.33% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709372324 T -> DEL N N silent_mutation Average:9.248; most accessible tissue: Callus, score: 44.707 N N N N
vg0709372324 T -> G LOC_Os07g16070.1 downstream_gene_variant ; 155.0bp to feature; MODIFIER silent_mutation Average:9.248; most accessible tissue: Callus, score: 44.707 N N N N
vg0709372324 T -> G LOC_Os07g16080.1 downstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:9.248; most accessible tissue: Callus, score: 44.707 N N N N
vg0709372324 T -> G LOC_Os07g16090.1 downstream_gene_variant ; 4758.0bp to feature; MODIFIER silent_mutation Average:9.248; most accessible tissue: Callus, score: 44.707 N N N N
vg0709372324 T -> G LOC_Os07g16070-LOC_Os07g16080 intergenic_region ; MODIFIER silent_mutation Average:9.248; most accessible tissue: Callus, score: 44.707 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709372324 9.20E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 NA 4.08E-18 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 9.95E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 NA 6.32E-41 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 1.09E-06 NA mr1098_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 2.20E-07 2.74E-17 mr1113_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 3.70E-08 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 1.17E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 8.66E-07 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 3.26E-07 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 3.54E-07 NA mr1120_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 3.54E-09 NA mr1123_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 1.78E-06 6.82E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 1.46E-08 NA mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 7.95E-09 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 5.72E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 2.59E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 NA 2.23E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 NA 2.32E-33 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 4.11E-07 3.09E-55 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 NA 2.51E-31 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 1.23E-07 3.30E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324 NA 4.41E-16 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251