Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709372324:

Variant ID: vg0709372324 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9372324
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTATGACTTTGTAAGAAATGCTTGTGAAATAGAAAAGAAATCTATCTAACTAAGTTTTCTTACTCTGGGTATGTCGTGTATGAGCGTTTTCTCACTT[T/G]
GCGACTTCGATCAGTCACTAGAGCTATACGCTCTCCATAGCTCCCAGCCTTGTAGTCAGAGAATCGTTCTCGGAGGACAAGGCTCTTGGACCCTTGACCT

Reverse complement sequence

AGGTCAAGGGTCCAAGAGCCTTGTCCTCCGAGAACGATTCTCTGACTACAAGGCTGGGAGCTATGGAGAGCGTATAGCTCTAGTGACTGATCGAAGTCGC[A/C]
AAGTGAGAAAACGCTCATACACGACATACCCAGAGTAAGAAAACTTAGTTAGATAGATTTCTTTTCTATTTCACAAGCATTTCTTACAAAGTCATAAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.10%	3.50%	2.58%	44.75%	NA
All Indica	2759	23.10%	0.60%	3.37%	73.00%	NA
All Japonica	1512	98.50%	0.50%	0.13%	0.93%	NA
Aus	269	29.70%	53.20%	5.58%	11.52%	NA
Indica I	595	38.80%	0.20%	2.86%	58.15%	NA
Indica II	465	13.10%	0.20%	3.66%	83.01%	NA
Indica III	913	11.20%	0.10%	3.40%	85.32%	NA
Indica Intermediate	786	30.80%	1.70%	3.56%	63.99%	NA
Temperate Japonica	767	98.70%	0.00%	0.13%	1.17%	NA
Tropical Japonica	504	99.00%	0.20%	0.00%	0.79%	NA
Japonica Intermediate	241	96.70%	2.50%	0.41%	0.41%	NA
VI/Aromatic	96	68.80%	0.00%	9.38%	21.88%	NA
Intermediate	90	56.70%	1.10%	3.33%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709372324	T -> DEL	N	N	silent_mutation	Average:9.248; most accessible tissue: Callus, score: 44.707	N	N	N	N
vg0709372324	T -> G	LOC_Os07g16070.1	downstream_gene_variant ; 155.0bp to feature; MODIFIER	silent_mutation	Average:9.248; most accessible tissue: Callus, score: 44.707	N	N	N	N
vg0709372324	T -> G	LOC_Os07g16080.1	downstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:9.248; most accessible tissue: Callus, score: 44.707	N	N	N	N
vg0709372324	T -> G	LOC_Os07g16090.1	downstream_gene_variant ; 4758.0bp to feature; MODIFIER	silent_mutation	Average:9.248; most accessible tissue: Callus, score: 44.707	N	N	N	N
vg0709372324	T -> G	LOC_Os07g16070-LOC_Os07g16080	intergenic_region ; MODIFIER	silent_mutation	Average:9.248; most accessible tissue: Callus, score: 44.707	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709372324	9.20E-06	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	NA	4.08E-18	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	9.95E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	NA	6.32E-41	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	1.09E-06	NA	mr1098_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	2.20E-07	2.74E-17	mr1113_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	3.70E-08	NA	mr1114_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	1.17E-06	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	8.66E-07	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	3.26E-07	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	3.54E-07	NA	mr1120_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	3.54E-09	NA	mr1123_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	1.78E-06	6.82E-18	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	1.46E-08	NA	mr1242_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	7.95E-09	NA	mr1247_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	5.72E-06	NA	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	2.59E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	NA	2.23E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	NA	2.32E-33	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	4.11E-07	3.09E-55	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	NA	2.51E-31	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	1.23E-07	3.30E-14	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709372324	NA	4.41E-16	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251