| Variant ID: vg0709360843 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9360843 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAGACCGAATGCCGGCAACGGTCAAAACGATCAAAGTACCTAAAAATACCTTTACCAAAGGCAAAAAGGGGAAGTACGAGCCGAACAGCCGTAACACGC[A/C]
CCACACCACATTTATTTGCCAAAAAAGCACAAGTTACAGATAAATTCCATTGCCCGCCAAAAGACATTCGGACTTTAGATCCGATTCATCAGCAAAAGCT
AGCTTTTGCTGATGAATCGGATCTAAAGTCCGAATGTCTTTTGGCGGGCAATGGAATTTATCTGTAACTTGTGCTTTTTTGGCAAATAAATGTGGTGTGG[T/G]
GCGTGTTACGGCTGTTCGGCTCGTACTTCCCCTTTTTGCCTTTGGTAAAGGTATTTTTAGGTACTTTGATCGTTTTGACCGTTGCCGGCATTCGGTCTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.00% | 1.10% | 9.69% | 41.24% | NA |
| All Indica | 2759 | 19.40% | 0.00% | 13.66% | 66.94% | NA |
| All Japonica | 1512 | 92.70% | 3.20% | 2.45% | 1.59% | NA |
| Aus | 269 | 75.50% | 0.00% | 10.78% | 13.75% | NA |
| Indica I | 595 | 23.90% | 0.00% | 5.38% | 70.76% | NA |
| Indica II | 465 | 14.60% | 0.00% | 15.48% | 69.89% | NA |
| Indica III | 913 | 14.50% | 0.00% | 17.09% | 68.46% | NA |
| Indica Intermediate | 786 | 24.60% | 0.00% | 14.89% | 60.56% | NA |
| Temperate Japonica | 767 | 90.90% | 6.40% | 1.43% | 1.30% | NA |
| Tropical Japonica | 504 | 93.30% | 0.00% | 4.76% | 1.98% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 82.30% | 0.00% | 9.38% | 8.33% | NA |
| Intermediate | 90 | 55.60% | 1.10% | 6.67% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709360843 | A -> DEL | N | N | silent_mutation | Average:11.303; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0709360843 | A -> C | LOC_Os07g16040.1 | downstream_gene_variant ; 3054.0bp to feature; MODIFIER | silent_mutation | Average:11.303; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0709360843 | A -> C | LOC_Os07g16054.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.303; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709360843 | NA | 8.22E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709360843 | NA | 1.32E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709360843 | NA | 6.19E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709360843 | 1.53E-06 | 8.31E-07 | mr1129_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709360843 | NA | 4.02E-07 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |