\
| Variant ID: vg0709339725 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9339725 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGGAATATAAATCGGAAAGGAAATTCACACATATGCACAGGCATCTTATTTGTTATTAAAAAATAATGCTAAAAGGAATCATATATATATAGAGAGAGA[C/G]
ACACACTGTAAGAGAATTTAGATTACCCTACAATAAGAAAAAAAAGAAATATATTTACCATAAAATAGACGGTAGATTTTAATATACTTCTAACGTGATA
TATCACGTTAGAAGTATATTAAAATCTACCGTCTATTTTATGGTAAATATATTTCTTTTTTTTCTTATTGTAGGGTAATCTAAATTCTCTTACAGTGTGT[G/C]
TCTCTCTCTATATATATATGATTCCTTTTAGCATTATTTTTTAATAACAAATAAGATGCCTGTGCATATGTGTGAATTTCCTTTCCGATTTATATTCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 0.50% | 6.39% | 10.52% | NA |
| All Indica | 2759 | 73.90% | 0.80% | 10.04% | 15.26% | NA |
| All Japonica | 1512 | 96.40% | 0.00% | 0.26% | 3.37% | NA |
| Aus | 269 | 95.50% | 0.40% | 1.86% | 2.23% | NA |
| Indica I | 595 | 64.00% | 0.80% | 7.39% | 27.73% | NA |
| Indica II | 465 | 82.60% | 0.90% | 7.10% | 9.46% | NA |
| Indica III | 913 | 79.50% | 1.10% | 9.42% | 9.97% | NA |
| Indica Intermediate | 786 | 69.60% | 0.50% | 14.50% | 15.39% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 89.70% | 0.00% | 0.40% | 9.92% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 7.29% | 13.54% | NA |
| Intermediate | 90 | 83.30% | 0.00% | 10.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709339725 | C -> DEL | N | N | silent_mutation | Average:21.38; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0709339725 | C -> G | LOC_Os07g16030.1 | upstream_gene_variant ; 4924.0bp to feature; MODIFIER | silent_mutation | Average:21.38; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| vg0709339725 | C -> G | LOC_Os07g16010-LOC_Os07g16030 | intergenic_region ; MODIFIER | silent_mutation | Average:21.38; most accessible tissue: Zhenshan97 root, score: 32.766 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709339725 | NA | 8.42E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | NA | 9.48E-07 | mr1187 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | NA | 2.76E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | NA | 2.61E-09 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | NA | 5.43E-06 | mr1371 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | 8.62E-06 | 8.62E-06 | mr1527 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | 6.76E-08 | 1.30E-07 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | 2.44E-06 | 4.30E-06 | mr1547 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | 7.61E-06 | 3.96E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | NA | 6.84E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709339725 | NA | 1.49E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |