\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709339725:

Variant ID: vg0709339725 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9339725
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGAATATAAATCGGAAAGGAAATTCACACATATGCACAGGCATCTTATTTGTTATTAAAAAATAATGCTAAAAGGAATCATATATATATAGAGAGAGA[C/G]
ACACACTGTAAGAGAATTTAGATTACCCTACAATAAGAAAAAAAAGAAATATATTTACCATAAAATAGACGGTAGATTTTAATATACTTCTAACGTGATA

Reverse complement sequence

TATCACGTTAGAAGTATATTAAAATCTACCGTCTATTTTATGGTAAATATATTTCTTTTTTTTCTTATTGTAGGGTAATCTAAATTCTCTTACAGTGTGT[G/C]
TCTCTCTCTATATATATATGATTCCTTTTAGCATTATTTTTTAATAACAAATAAGATGCCTGTGCATATGTGTGAATTTCCTTTCCGATTTATATTCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 0.50% 6.39% 10.52% NA
All Indica  2759 73.90% 0.80% 10.04% 15.26% NA
All Japonica  1512 96.40% 0.00% 0.26% 3.37% NA
Aus  269 95.50% 0.40% 1.86% 2.23% NA
Indica I  595 64.00% 0.80% 7.39% 27.73% NA
Indica II  465 82.60% 0.90% 7.10% 9.46% NA
Indica III  913 79.50% 1.10% 9.42% 9.97% NA
Indica Intermediate  786 69.60% 0.50% 14.50% 15.39% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 89.70% 0.00% 0.40% 9.92% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 79.20% 0.00% 7.29% 13.54% NA
Intermediate  90 83.30% 0.00% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709339725 C -> DEL N N silent_mutation Average:21.38; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0709339725 C -> G LOC_Os07g16030.1 upstream_gene_variant ; 4924.0bp to feature; MODIFIER silent_mutation Average:21.38; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N
vg0709339725 C -> G LOC_Os07g16010-LOC_Os07g16030 intergenic_region ; MODIFIER silent_mutation Average:21.38; most accessible tissue: Zhenshan97 root, score: 32.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709339725 NA 8.42E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 NA 9.48E-07 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 NA 2.76E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 NA 2.61E-09 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 NA 5.43E-06 mr1371 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 8.62E-06 8.62E-06 mr1527 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 6.76E-08 1.30E-07 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 2.44E-06 4.30E-06 mr1547 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 7.61E-06 3.96E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 NA 6.84E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709339725 NA 1.49E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251