\
| Variant ID: vg0709331066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9331066 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.32, others allele: 0.00, population size: 62. )
CCAAGTGGCTTCATCCTCAGTGTGATTACTCCACTGTACCTTATACATACGCCATACTTTGTTCCTAGTCCTCTTTTCTGCTTCATCCAATATCCGGACT[A/G]
GGTGTTCTGGATACGTGAGATCATTGCTAATGTGAATTTCTTCCAACGGAGCTTGTTCTTCCGGCACTCGTAAGCATTTCTTTAATTGAGACACATGGAA
TTCCATGTGTCTCAATTAAAGAAATGCTTACGAGTGCCGGAAGAACAAGCTCCGTTGGAAGAAATTCACATTAGCAATGATCTCACGTATCCAGAACACC[T/C]
AGTCCGGATATTGGATGAAGCAGAAAAGAGGACTAGGAACAAAGTATGGCGTATGTATAAGGTACAGTGGAGTAATCACACTGAGGATGAAGCCACTTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.10% | 0.20% | 1.61% | 59.08% | NA |
| All Indica | 2759 | 5.50% | 0.30% | 2.68% | 91.48% | NA |
| All Japonica | 1512 | 94.70% | 0.00% | 0.13% | 5.16% | NA |
| Aus | 269 | 65.40% | 0.00% | 0.00% | 34.57% | NA |
| Indica I | 595 | 7.20% | 0.00% | 1.85% | 90.92% | NA |
| Indica II | 465 | 7.50% | 0.00% | 2.15% | 90.32% | NA |
| Indica III | 913 | 2.00% | 0.90% | 3.29% | 93.87% | NA |
| Indica Intermediate | 786 | 7.10% | 0.10% | 2.93% | 89.82% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.13% | 1.96% | NA |
| Tropical Japonica | 504 | 88.50% | 0.00% | 0.20% | 11.31% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 49.00% | 0.00% | 0.00% | 51.04% | NA |
| Intermediate | 90 | 46.70% | 0.00% | 0.00% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709331066 | A -> DEL | LOC_Os07g16010.1 | N | frameshift_variant | Average:14.047; most accessible tissue: Callus, score: 17.287 | N | N | N | N |
| vg0709331066 | A -> G | LOC_Os07g16010.1 | missense_variant ; p.Leu158Pro; MODERATE | nonsynonymous_codon ; L158P | Average:14.047; most accessible tissue: Callus, score: 17.287 | benign |
-0.005 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709331066 | NA | 1.56E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 1.50E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 3.76E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | 9.54E-07 | NA | mr1203 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 3.36E-31 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 3.13E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 3.17E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | 5.97E-06 | NA | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | 9.63E-07 | NA | mr1618 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 1.88E-20 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 1.93E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 1.12E-06 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709331066 | NA | 1.20E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |