Variant ID: vg0709322762 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 9322762 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 53. )
CAACGTTTGCTTTGCCGGGGTGGTAGTGAACCTCTAGATCATAGTCCTTGATTAATTCCAGCCATCGCCTTTGCCTCAAGTTGAGATCTGACTGGGTGAA[A/G]
ATATACTTCAGACTCTTGTGGTCAATGTAGATATCGCAATGGTTTCCAATCAAGTAGTGTCTCCAAATCTTTAGCGCATGAACCACGGCTGCTAGTTCTA
TAGAACTAGCAGCCGTGGTTCATGCGCTAAAGATTTGGAGACACTACTTGATTGGAAACCATTGCGATATCTACATTGACCACAAGAGTCTGAAGTATAT[T/C]
TTCACCCAGTCAGATCTCAACTTGAGGCAAAGGCGATGGCTGGAATTAATCAAGGACTATGATCTAGAGGTTCACTACCACCCCGGCAAAGCAAACGTTG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 39.00% | 0.20% | 11.96% | 48.86% | NA |
All Indica | 2759 | 5.20% | 0.30% | 17.25% | 77.27% | NA |
All Japonica | 1512 | 94.30% | 0.00% | 1.92% | 3.77% | NA |
Aus | 269 | 68.40% | 0.40% | 11.90% | 19.33% | NA |
Indica I | 595 | 4.70% | 1.00% | 15.63% | 78.66% | NA |
Indica II | 465 | 6.20% | 0.00% | 11.18% | 82.58% | NA |
Indica III | 913 | 3.70% | 0.00% | 16.10% | 80.18% | NA |
Indica Intermediate | 786 | 6.60% | 0.30% | 23.41% | 69.72% | NA |
Temperate Japonica | 767 | 96.90% | 0.00% | 0.52% | 2.61% | NA |
Tropical Japonica | 504 | 88.90% | 0.00% | 4.56% | 6.55% | NA |
Japonica Intermediate | 241 | 97.50% | 0.00% | 0.83% | 1.66% | NA |
VI/Aromatic | 96 | 51.00% | 0.00% | 25.00% | 23.96% | NA |
Intermediate | 90 | 45.60% | 0.00% | 4.44% | 50.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0709322762 | A -> DEL | LOC_Os07g16000.1 | N | frameshift_variant | Average:22.075; most accessible tissue: Callus, score: 34.995 | N | N | N | N |
vg0709322762 | A -> G | LOC_Os07g16000.1 | synonymous_variant ; p.Ile1130Ile; LOW | synonymous_codon | Average:22.075; most accessible tissue: Callus, score: 34.995 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0709322762 | NA | 3.19E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 3.91E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 5.82E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 7.19E-07 | mr1717 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 1.50E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 5.50E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 2.85E-16 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | 2.52E-06 | NA | mr1296_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | 3.72E-06 | NA | mr1296_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709322762 | NA | 2.01E-12 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |