\
| Variant ID: vg0709254491 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9254491 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCCTCTTAGGTGGAAGGTAACTACTCCCTCCTTCCCTAAATATTTGACACCGTTGACCTTTTGTAACATGTTTGACCGTTCGTTTTATTCAAAAACTTTT[G/A]
TGATATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAACAATTACTTAAATTTTTTTTGAATAAGA
TCTTATTCAAAAAAAATTTAAGTAATTGTTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATATCA[C/T]
AAAAGTTTTTGAATAAAACGAACGGTCAAACATGTTACAAAAGGTCAACGGTGTCAAATATTTAGGGAAGGAGGGAGTAGTTACCTTCCACCTAAGAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 42.80% | 0.19% | 0.08% | NA |
| All Indica | 2759 | 91.30% | 8.40% | 0.14% | 0.11% | NA |
| All Japonica | 1512 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 12.60% | 86.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.80% | 0.34% | 0.17% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 90.00% | 9.70% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 84.40% | 15.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.70% | 88.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 40.00% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709254491 | G -> DEL | N | N | silent_mutation | Average:47.444; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0709254491 | G -> A | LOC_Os07g15920.1 | downstream_gene_variant ; 4208.0bp to feature; MODIFIER | silent_mutation | Average:47.444; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0709254491 | G -> A | LOC_Os07g15930.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.444; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709254491 | NA | 2.47E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 1.74E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 3.08E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 6.27E-13 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 3.70E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 2.86E-29 | mr1580_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | 3.10E-06 | 3.65E-07 | mr1713_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 3.61E-29 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 9.97E-06 | mr1862_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 6.30E-17 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709254491 | NA | 2.53E-25 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |