\
| Variant ID: vg0709186195 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9186195 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
CAAGAGATGACAAAAATAAAAAAAGAAGTGCGTGTATATATGCACGTACATATACGAGATGTCAAAAATAAAAAAGAAGTGTGTGTATATGGTCCACCAC[G/A]
TCTGGTATTTTTCAATTTCTTTCTTTGTAGCCCTTAGGTTCTCCTTAAATTATACATATATGTAGCGACCACTCTTTGCGAGGTTGTCGAAGAAGCCACG
CGTGGCTTCTTCGACAACCTCGCAAAGAGTGGTCGCTACATATATGTATAATTTAAGGAGAACCTAAGGGCTACAAAGAAAGAAATTGAAAAATACCAGA[C/T]
GTGGTGGACCATATACACACACTTCTTTTTTATTTTTGACATCTCGTATATGTACGTGCATATATACACGCACTTCTTTTTTTATTTTTGTCATCTCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.00% | 0.60% | 0.49% | 0.91% | NA |
| All Indica | 2759 | 98.30% | 0.00% | 0.14% | 1.56% | NA |
| All Japonica | 1512 | 97.00% | 1.80% | 1.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 0.00% | 0.34% | 3.87% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.00% | 0.86% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 0.00% | 0.25% | 2.04% | NA |
| Temperate Japonica | 767 | 94.00% | 3.50% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709186195 | G -> DEL | N | N | silent_mutation | Average:24.217; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0709186195 | G -> A | LOC_Os07g15820.1 | downstream_gene_variant ; 2699.0bp to feature; MODIFIER | silent_mutation | Average:24.217; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0709186195 | G -> A | LOC_Os07g15800-LOC_Os07g15820 | intergenic_region ; MODIFIER | silent_mutation | Average:24.217; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709186195 | NA | 6.86E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 3.83E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 2.34E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 8.66E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | 4.70E-06 | 4.70E-06 | mr1074_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | 1.62E-06 | 1.62E-06 | mr1081_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 7.47E-06 | mr1298_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 9.12E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 2.96E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 2.80E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 8.95E-06 | mr1731_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 2.10E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709186195 | NA | 9.50E-06 | mr1986_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |