\
| Variant ID: vg0709175210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9175210 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )
CTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCAAGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCAACAAG[T/C]
GGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCT
AGGAGCCTGAGGTGGAGACGGTGCTGGAGCATGAGGAGGAGACGGTGCAGGATCCTGAGGAGGAGATGGCGGAGCCGGAGGAGATGGTGCACGAGACGCC[A/G]
CTTGTTGCCCAGGGAGGATGATGTACCGCCTGCGCCATAGAATAATGGCTTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAATCCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.00% | 4.70% | 18.62% | 35.67% | NA |
| All Indica | 2759 | 13.40% | 0.10% | 28.31% | 58.21% | NA |
| All Japonica | 1512 | 80.00% | 14.30% | 3.64% | 2.12% | NA |
| Aus | 269 | 88.80% | 0.00% | 5.20% | 5.95% | NA |
| Indica I | 595 | 9.10% | 0.00% | 44.37% | 46.55% | NA |
| Indica II | 465 | 12.30% | 0.00% | 18.49% | 69.25% | NA |
| Indica III | 913 | 12.70% | 0.00% | 26.07% | 61.23% | NA |
| Indica Intermediate | 786 | 18.20% | 0.30% | 24.55% | 57.00% | NA |
| Temperate Japonica | 767 | 73.00% | 24.10% | 0.39% | 2.48% | NA |
| Tropical Japonica | 504 | 88.10% | 0.20% | 9.72% | 1.98% | NA |
| Japonica Intermediate | 241 | 85.10% | 12.40% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 83.30% | 2.10% | 14.58% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 1.10% | 17.78% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709175210 | T -> DEL | LOC_Os07g15800.1 | N | frameshift_variant | Average:13.902; most accessible tissue: Callus, score: 20.5 | N | N | N | N |
| vg0709175210 | T -> C | LOC_Os07g15800.1 | missense_variant ; p.Val468Ala; MODERATE | nonsynonymous_codon ; V468A | Average:13.902; most accessible tissue: Callus, score: 20.5 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709175210 | NA | 3.62E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 2.35E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 1.68E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 7.03E-06 | mr1363 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 9.97E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | 2.30E-06 | 2.30E-06 | mr1527 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 3.47E-06 | mr1532 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 1.83E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 8.19E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | 4.92E-07 | 4.92E-07 | mr1893 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | 2.19E-06 | 3.03E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | 7.18E-06 | 4.43E-06 | mr1293_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 1.20E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 2.30E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 7.20E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 7.66E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709175210 | NA | 1.04E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |