\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709175210:

Variant ID: vg0709175210 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9175210
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGATTACCCTGGAGGAGACGGTGAGACGCATCTACGAGACACAAGCCAAGCCATTATTCTATGGCGCAGGCGGTACATCATCCTCCCTGGGCAACAAG[T/C]
GGCGTCTCGTGCACCATCTCCTCCGGCTCCGCCATCTCCTCCTCAGGATCCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTCAGGCTCCT

Reverse complement sequence

AGGAGCCTGAGGTGGAGACGGTGCTGGAGCATGAGGAGGAGACGGTGCAGGATCCTGAGGAGGAGATGGCGGAGCCGGAGGAGATGGTGCACGAGACGCC[A/G]
CTTGTTGCCCAGGGAGGATGATGTACCGCCTGCGCCATAGAATAATGGCTTGGCTTGTGTCTCGTAGATGCGTCTCACCGTCTCCTCCAGGGTAATCCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.00% 4.70% 18.62% 35.67% NA
All Indica  2759 13.40% 0.10% 28.31% 58.21% NA
All Japonica  1512 80.00% 14.30% 3.64% 2.12% NA
Aus  269 88.80% 0.00% 5.20% 5.95% NA
Indica I  595 9.10% 0.00% 44.37% 46.55% NA
Indica II  465 12.30% 0.00% 18.49% 69.25% NA
Indica III  913 12.70% 0.00% 26.07% 61.23% NA
Indica Intermediate  786 18.20% 0.30% 24.55% 57.00% NA
Temperate Japonica  767 73.00% 24.10% 0.39% 2.48% NA
Tropical Japonica  504 88.10% 0.20% 9.72% 1.98% NA
Japonica Intermediate  241 85.10% 12.40% 1.24% 1.24% NA
VI/Aromatic  96 83.30% 2.10% 14.58% 0.00% NA
Intermediate  90 45.60% 1.10% 17.78% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709175210 T -> DEL LOC_Os07g15800.1 N frameshift_variant Average:13.902; most accessible tissue: Callus, score: 20.5 N N N N
vg0709175210 T -> C LOC_Os07g15800.1 missense_variant ; p.Val468Ala; MODERATE nonsynonymous_codon ; V468A Average:13.902; most accessible tissue: Callus, score: 20.5 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709175210 NA 3.62E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 2.35E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 1.68E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 7.03E-06 mr1363 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 9.97E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 2.30E-06 2.30E-06 mr1527 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 3.47E-06 mr1532 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 1.83E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 8.19E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 4.92E-07 4.92E-07 mr1893 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 2.19E-06 3.03E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 7.18E-06 4.43E-06 mr1293_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 1.20E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 2.30E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 7.20E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 7.66E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709175210 NA 1.04E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251