\
| Variant ID: vg0709174478 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9174478 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 94. )
GATATGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTGACGGCACGTTTCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTG[C/T]
AGACTCTAGAGCATCCAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACATACAGGAGTGGGATGAGGAG
CTCCTCATCCCACTCCTGTATGTGTGGATGTCCTCCTTGAACCCAATCTTCCAAGGAATCACCCCTTTCCCTCGTGTTTGTCCTGGATGCTCTAGAGTCT[G/A]
CAGGGCGAGTGACAGCTCGTCCCTCTCTCTATCCGGTCGAAACGTGCCGTCAGAAGAGGCTTCCACTGCGTCTGTTAGTCGACGCGCAGCCTCTCATATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 37.60% | 3.11% | 0.06% | NA |
| All Indica | 2759 | 92.20% | 2.70% | 5.00% | 0.11% | NA |
| All Japonica | 1512 | 6.00% | 94.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 33.50% | 64.70% | 1.86% | 0.00% | NA |
| Indica I | 595 | 82.50% | 2.40% | 14.62% | 0.50% | NA |
| Indica II | 465 | 94.40% | 4.30% | 1.29% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 4.60% | 5.47% | 0.00% | NA |
| Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.70% | 88.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 42.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709174478 | C -> DEL | N | N | silent_mutation | Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0709174478 | C -> T | LOC_Os07g15800.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0709174478 | C -> T | LOC_Os07g15790.1 | downstream_gene_variant ; 3950.0bp to feature; MODIFIER | silent_mutation | Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709174478 | NA | 8.65E-16 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 8.70E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 6.52E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 2.13E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 1.16E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 3.52E-14 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 6.79E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 9.79E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 2.22E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 3.92E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 3.61E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 8.79E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 5.73E-07 | mr1872_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709174478 | NA | 6.78E-08 | mr1961_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |