Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709174478:

Variant ID: vg0709174478 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9174478
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GATATGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTGACGGCACGTTTCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTG[C/T]
AGACTCTAGAGCATCCAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACATACAGGAGTGGGATGAGGAG

Reverse complement sequence

CTCCTCATCCCACTCCTGTATGTGTGGATGTCCTCCTTGAACCCAATCTTCCAAGGAATCACCCCTTTCCCTCGTGTTTGTCCTGGATGCTCTAGAGTCT[G/A]
CAGGGCGAGTGACAGCTCGTCCCTCTCTCTATCCGGTCGAAACGTGCCGTCAGAAGAGGCTTCCACTGCGTCTGTTAGTCGACGCGCAGCCTCTCATATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	37.60%	3.11%	0.06%	NA
All Indica	2759	92.20%	2.70%	5.00%	0.11%	NA
All Japonica	1512	6.00%	94.00%	0.07%	0.00%	NA
Aus	269	33.50%	64.70%	1.86%	0.00%	NA
Indica I	595	82.50%	2.40%	14.62%	0.50%	NA
Indica II	465	94.40%	4.30%	1.29%	0.00%	NA
Indica III	913	99.30%	0.40%	0.22%	0.00%	NA
Indica Intermediate	786	89.90%	4.60%	5.47%	0.00%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	11.70%	88.30%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.50%	0.41%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709174478	C -> DEL	N	N	silent_mutation	Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0709174478	C -> T	LOC_Os07g15800.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0709174478	C -> T	LOC_Os07g15790.1	downstream_gene_variant ; 3950.0bp to feature; MODIFIER	silent_mutation	Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709174478	NA	8.65E-16	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	8.70E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	6.52E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	2.13E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	1.16E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	3.52E-14	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	6.79E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	9.79E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	2.22E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	3.92E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	3.61E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	8.79E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	5.73E-07	mr1872_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478	NA	6.78E-08	mr1961_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251