\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709174478:

Variant ID: vg0709174478 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9174478
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GATATGAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAGCCTCTTCTGACGGCACGTTTCGACCGGATAGAGAGAGGGACGAGCTGTCACTCGCCCTG[C/T]
AGACTCTAGAGCATCCAGGACAAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGACATCCACACATACAGGAGTGGGATGAGGAG

Reverse complement sequence

CTCCTCATCCCACTCCTGTATGTGTGGATGTCCTCCTTGAACCCAATCTTCCAAGGAATCACCCCTTTCCCTCGTGTTTGTCCTGGATGCTCTAGAGTCT[G/A]
CAGGGCGAGTGACAGCTCGTCCCTCTCTCTATCCGGTCGAAACGTGCCGTCAGAAGAGGCTTCCACTGCGTCTGTTAGTCGACGCGCAGCCTCTCATATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 37.60% 3.11% 0.06% NA
All Indica  2759 92.20% 2.70% 5.00% 0.11% NA
All Japonica  1512 6.00% 94.00% 0.07% 0.00% NA
Aus  269 33.50% 64.70% 1.86% 0.00% NA
Indica I  595 82.50% 2.40% 14.62% 0.50% NA
Indica II  465 94.40% 4.30% 1.29% 0.00% NA
Indica III  913 99.30% 0.40% 0.22% 0.00% NA
Indica Intermediate  786 89.90% 4.60% 5.47% 0.00% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 11.70% 88.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 54.40% 42.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709174478 C -> DEL N N silent_mutation Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0709174478 C -> T LOC_Os07g15800.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0709174478 C -> T LOC_Os07g15790.1 downstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:12.255; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709174478 NA 8.65E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 8.70E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 6.52E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 2.13E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 1.16E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 3.52E-14 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 6.79E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 9.79E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 2.22E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 3.92E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 3.61E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 8.79E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 5.73E-07 mr1872_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709174478 NA 6.78E-08 mr1961_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251