\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709172670:

Variant ID: vg0709172670 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9172670
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAATGCAATTAAGATTATTAGATTTGTAATTAGACTTAATTAGAATATAAGATTGTGTAGTGTTCTAATATACGACAGTTACACTTAGAATACATGA[T/C]
TATTTGAGTTTTAGTATAAGATTATTGGAGTTTTAATATAAGATTATTATATTTGTAATTAGACTTAGTATATAATTATTGACTAGCTAGGGTCCTATAA

Reverse complement sequence

TTATAGGACCCTAGCTAGTCAATAATTATATACTAAGTCTAATTACAAATATAATAATCTTATATTAAAACTCCAATAATCTTATACTAAAACTCAAATA[A/G]
TCATGTATTCTAAGTGTAACTGTCGTATATTAGAACACTACACAATCTTATATTCTAATTAAGTCTAATTACAAATCTAATAATCTTAATTGCATTACAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 24.80% 20.23% 16.67% NA
All Indica  2759 3.80% 39.40% 29.36% 27.44% NA
All Japonica  1512 94.10% 0.70% 4.43% 0.79% NA
Aus  269 67.30% 19.70% 11.15% 1.86% NA
Indica I  595 3.70% 58.00% 9.58% 28.74% NA
Indica II  465 5.80% 26.70% 34.19% 33.33% NA
Indica III  913 1.20% 38.00% 35.93% 24.86% NA
Indica Intermediate  786 5.60% 34.60% 33.84% 25.95% NA
Temperate Japonica  767 96.60% 0.40% 2.22% 0.78% NA
Tropical Japonica  504 88.70% 1.20% 9.52% 0.60% NA
Japonica Intermediate  241 97.50% 0.40% 0.83% 1.24% NA
VI/Aromatic  96 63.50% 7.30% 28.12% 1.04% NA
Intermediate  90 45.60% 15.60% 24.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709172670 T -> DEL N N silent_mutation Average:9.17; most accessible tissue: Minghui63 young leaf, score: 15.967 N N N N
vg0709172670 T -> C LOC_Os07g15790.1 downstream_gene_variant ; 2142.0bp to feature; MODIFIER silent_mutation Average:9.17; most accessible tissue: Minghui63 young leaf, score: 15.967 N N N N
vg0709172670 T -> C LOC_Os07g15800.1 intron_variant ; MODIFIER silent_mutation Average:9.17; most accessible tissue: Minghui63 young leaf, score: 15.967 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709172670 NA 1.47E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 8.55E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 1.46E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 7.86E-06 mr1363 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 4.38E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 1.24E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 8.04E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 5.08E-21 mr1971 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 3.16E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 9.57E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 7.44E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 7.62E-06 mr1657_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 4.88E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 9.90E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 2.17E-07 mr1872_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172670 NA 8.29E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251