Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709172569:

Variant ID: vg0709172569 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9172569
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGACGTTGTCGGAGTTGTCCCTCAAGCCAGAGTGGTAGAGCTAGCCCTCGAAGGAATTCGCCCAGGCAAGTGACATAATTATATATATGATTGTTATA[A/T]
TTGTAATGCAATTAAGATTATTAGATTTGTAATTAGACTTAATTAGAATATAAGATTGTGTAGTGTTCTAATATACGACAGTTACACTTAGAATACATGA

Reverse complement sequence

TCATGTATTCTAAGTGTAACTGTCGTATATTAGAACACTACACAATCTTATATTCTAATTAAGTCTAATTACAAATCTAATAATCTTAATTGCATTACAA[T/A]
TATAACAATCATATATATAATTATGTCACTTGCCTGGGCGAATTCCTTCGAGGGCTAGCTCTACCACTCTGGCTTGAGGGACAACTCCGACAACGTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	37.10%	1.16%	1.95%	NA
All Indica	2759	92.80%	2.20%	1.74%	3.30%	NA
All Japonica	1512	6.00%	93.90%	0.00%	0.07%	NA
Aus	269	33.10%	65.10%	1.86%	0.00%	NA
Indica I	595	84.00%	1.20%	5.04%	9.75%	NA
Indica II	465	94.80%	3.70%	0.65%	0.86%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	90.20%	4.50%	1.65%	3.69%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	11.70%	88.30%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.10%	0.00%	0.41%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709172569	A -> DEL	N	N	silent_mutation	Average:10.447; most accessible tissue: Callus, score: 21.544	N	N	N	N
vg0709172569	A -> T	LOC_Os07g15790.1	downstream_gene_variant ; 2041.0bp to feature; MODIFIER	silent_mutation	Average:10.447; most accessible tissue: Callus, score: 21.544	N	N	N	N
vg0709172569	A -> T	LOC_Os07g15800.1	intron_variant ; MODIFIER	silent_mutation	Average:10.447; most accessible tissue: Callus, score: 21.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709172569	NA	4.28E-10	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0709172569	7.54E-07	1.58E-07	mr1002	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	4.18E-22	mr1020	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.77E-19	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.12E-14	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.44E-09	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	2.93E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	5.84E-18	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	5.60E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	8.85E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.11E-14	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	5.08E-06	2.67E-11	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	4.22E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	5.28E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	9.47E-16	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	4.57E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	2.39E-22	mr1971	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	5.85E-08	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	8.86E-06	7.09E-12	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	6.40E-60	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.66E-12	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.91E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	8.74E-11	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	1.23E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	3.91E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709172569	NA	4.37E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251