\
| Variant ID: vg0709163089 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9163089 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, A: 0.16, others allele: 0.00, population size: 82. )
TCAGACCTAACCCTTTTTATCTTTCTGTCAAGTTGATTTTCAACTTCTGCCTTATAAATTTTAAAATAGTCTAGAGCTTCGTCTTTCGTTTTCAACAAGT[T/A]
CACATAGCAAAATCTAGTAGCATCATCAATCAACGTCATGAAATATCGTTTTCCACCCTTCGTCAACACCCCATTCATTTCACAAAGATCTGAATGTAGG
CCTACATTCAGATCTTTGTGAAATGAATGGGGTGTTGACGAAGGGTGGAAAACGATATTTCATGACGTTGATTGATGATGCTACTAGATTTTGCTATGTG[A/T]
ACTTGTTGAAAACGAAAGACGAAGCTCTAGACTATTTTAAAATTTATAAGGCAGAAGTTGAAAATCAACTTGACAGAAAGATAAAAAGGGTTAGGTCTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.30% | 6.20% | 6.94% | 48.65% | NA |
| All Indica | 2759 | 4.50% | 8.80% | 8.84% | 77.85% | NA |
| All Japonica | 1512 | 92.50% | 1.80% | 3.17% | 2.58% | NA |
| Aus | 269 | 68.40% | 1.90% | 1.86% | 27.88% | NA |
| Indica I | 595 | 4.20% | 2.20% | 5.38% | 88.24% | NA |
| Indica II | 465 | 5.80% | 9.90% | 12.26% | 72.04% | NA |
| Indica III | 913 | 2.30% | 8.50% | 9.64% | 79.52% | NA |
| Indica Intermediate | 786 | 6.50% | 13.50% | 8.52% | 71.50% | NA |
| Temperate Japonica | 767 | 94.30% | 2.10% | 0.13% | 3.52% | NA |
| Tropical Japonica | 504 | 88.90% | 2.00% | 8.73% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.20% | 0.40% | 1.24% | 4.15% | NA |
| VI/Aromatic | 96 | 63.50% | 7.30% | 27.08% | 2.08% | NA |
| Intermediate | 90 | 45.60% | 10.00% | 5.56% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709163089 | T -> DEL | LOC_Os07g15780.1 | N | frameshift_variant | Average:10.56; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0709163089 | T -> A | LOC_Os07g15780.1 | missense_variant ; p.Asn379Tyr; MODERATE | nonsynonymous_codon | Average:10.56; most accessible tissue: Zhenshan97 panicle, score: 20.424 | probably damaging |
-2.295 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709163089 | NA | 3.72E-11 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0709163089 | NA | 2.59E-08 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 5.35E-14 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 2.25E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 6.89E-12 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 4.35E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 8.58E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 3.81E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 2.14E-06 | mr1520_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 9.07E-06 | mr1561_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 2.58E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709163089 | NA | 2.50E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |