Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709147678:

Variant ID: vg0709147678 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9147678
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCGGAACATTATCAAATATCCCGGACTTGGGGGGCATGTGTTAACAACCAAATTTGGTAATATCAGCATCGGAAGAGGAGACTAGATCCAGGTGGAGTC[G/A]
AAGGCGGAGATTGATTCGAGAACAGAGCAAGAATCGGCAGAAGTCCAGATCGGCTACGATTAGGATCGGCTGGGTCTAGGTCGGACTAGGTAAGCCGATG

Reverse complement sequence

CATCGGCTTACCTAGTCCGACCTAGACCCAGCCGATCCTAATCGTAGCCGATCTGGACTTCTGCCGATTCTTGCTCTGTTCTCGAATCAATCTCCGCCTT[C/T]
GACTCCACCTGGATCTAGTCTCCTCTTCCGATGCTGATATTACCAAATTTGGTTGTTAACACATGCCCCCCAAGTCCGGGATATTTGATAATGTTCCGGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.20%	28.60%	18.85%	8.38%	NA
All Indica	2759	11.90%	45.00%	29.97%	13.08%	NA
All Japonica	1512	95.10%	1.30%	1.79%	1.79%	NA
Aus	269	68.80%	25.30%	4.46%	1.49%	NA
Indica I	595	19.70%	52.60%	24.54%	3.19%	NA
Indica II	465	7.30%	45.40%	35.70%	11.61%	NA
Indica III	913	2.40%	44.10%	32.75%	20.70%	NA
Indica Intermediate	786	19.80%	40.10%	27.48%	12.60%	NA
Temperate Japonica	767	96.50%	0.30%	0.91%	2.35%	NA
Tropical Japonica	504	92.90%	3.20%	3.77%	0.20%	NA
Japonica Intermediate	241	95.40%	0.80%	0.41%	3.32%	NA
VI/Aromatic	96	93.80%	4.20%	2.08%	0.00%	NA
Intermediate	90	51.10%	18.90%	25.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709147678	G -> DEL	N	N	silent_mutation	Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0709147678	G -> A	LOC_Os07g15760.1	upstream_gene_variant ; 320.0bp to feature; MODIFIER	silent_mutation	Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0709147678	G -> A	LOC_Os07g15750.1	downstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0709147678	G -> A	LOC_Os07g15770.1	downstream_gene_variant ; 4724.0bp to feature; MODIFIER	silent_mutation	Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0709147678	G -> A	LOC_Os07g15760-LOC_Os07g15770	intergenic_region ; MODIFIER	silent_mutation	Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709147678	NA	3.00E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678	NA	9.93E-11	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678	NA	6.07E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678	1.67E-06	9.97E-07	mr1657_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678	NA	5.14E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678	NA	4.81E-31	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251