\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709147678:

Variant ID: vg0709147678 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9147678
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGGAACATTATCAAATATCCCGGACTTGGGGGGCATGTGTTAACAACCAAATTTGGTAATATCAGCATCGGAAGAGGAGACTAGATCCAGGTGGAGTC[G/A]
AAGGCGGAGATTGATTCGAGAACAGAGCAAGAATCGGCAGAAGTCCAGATCGGCTACGATTAGGATCGGCTGGGTCTAGGTCGGACTAGGTAAGCCGATG

Reverse complement sequence

CATCGGCTTACCTAGTCCGACCTAGACCCAGCCGATCCTAATCGTAGCCGATCTGGACTTCTGCCGATTCTTGCTCTGTTCTCGAATCAATCTCCGCCTT[C/T]
GACTCCACCTGGATCTAGTCTCCTCTTCCGATGCTGATATTACCAAATTTGGTTGTTAACACATGCCCCCCAAGTCCGGGATATTTGATAATGTTCCGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 28.60% 18.85% 8.38% NA
All Indica  2759 11.90% 45.00% 29.97% 13.08% NA
All Japonica  1512 95.10% 1.30% 1.79% 1.79% NA
Aus  269 68.80% 25.30% 4.46% 1.49% NA
Indica I  595 19.70% 52.60% 24.54% 3.19% NA
Indica II  465 7.30% 45.40% 35.70% 11.61% NA
Indica III  913 2.40% 44.10% 32.75% 20.70% NA
Indica Intermediate  786 19.80% 40.10% 27.48% 12.60% NA
Temperate Japonica  767 96.50% 0.30% 0.91% 2.35% NA
Tropical Japonica  504 92.90% 3.20% 3.77% 0.20% NA
Japonica Intermediate  241 95.40% 0.80% 0.41% 3.32% NA
VI/Aromatic  96 93.80% 4.20% 2.08% 0.00% NA
Intermediate  90 51.10% 18.90% 25.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709147678 G -> DEL N N silent_mutation Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0709147678 G -> A LOC_Os07g15760.1 upstream_gene_variant ; 320.0bp to feature; MODIFIER silent_mutation Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0709147678 G -> A LOC_Os07g15750.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0709147678 G -> A LOC_Os07g15770.1 downstream_gene_variant ; 4724.0bp to feature; MODIFIER silent_mutation Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0709147678 G -> A LOC_Os07g15760-LOC_Os07g15770 intergenic_region ; MODIFIER silent_mutation Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709147678 NA 3.00E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678 NA 9.93E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678 NA 6.07E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678 1.67E-06 9.97E-07 mr1657_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678 NA 5.14E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709147678 NA 4.81E-31 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251