\
| Variant ID: vg0709147678 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9147678 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCGGAACATTATCAAATATCCCGGACTTGGGGGGCATGTGTTAACAACCAAATTTGGTAATATCAGCATCGGAAGAGGAGACTAGATCCAGGTGGAGTC[G/A]
AAGGCGGAGATTGATTCGAGAACAGAGCAAGAATCGGCAGAAGTCCAGATCGGCTACGATTAGGATCGGCTGGGTCTAGGTCGGACTAGGTAAGCCGATG
CATCGGCTTACCTAGTCCGACCTAGACCCAGCCGATCCTAATCGTAGCCGATCTGGACTTCTGCCGATTCTTGCTCTGTTCTCGAATCAATCTCCGCCTT[C/T]
GACTCCACCTGGATCTAGTCTCCTCTTCCGATGCTGATATTACCAAATTTGGTTGTTAACACATGCCCCCCAAGTCCGGGATATTTGATAATGTTCCGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.20% | 28.60% | 18.85% | 8.38% | NA |
| All Indica | 2759 | 11.90% | 45.00% | 29.97% | 13.08% | NA |
| All Japonica | 1512 | 95.10% | 1.30% | 1.79% | 1.79% | NA |
| Aus | 269 | 68.80% | 25.30% | 4.46% | 1.49% | NA |
| Indica I | 595 | 19.70% | 52.60% | 24.54% | 3.19% | NA |
| Indica II | 465 | 7.30% | 45.40% | 35.70% | 11.61% | NA |
| Indica III | 913 | 2.40% | 44.10% | 32.75% | 20.70% | NA |
| Indica Intermediate | 786 | 19.80% | 40.10% | 27.48% | 12.60% | NA |
| Temperate Japonica | 767 | 96.50% | 0.30% | 0.91% | 2.35% | NA |
| Tropical Japonica | 504 | 92.90% | 3.20% | 3.77% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.80% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 93.80% | 4.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 18.90% | 25.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709147678 | G -> DEL | N | N | silent_mutation | Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0709147678 | G -> A | LOC_Os07g15760.1 | upstream_gene_variant ; 320.0bp to feature; MODIFIER | silent_mutation | Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0709147678 | G -> A | LOC_Os07g15750.1 | downstream_gene_variant ; 3911.0bp to feature; MODIFIER | silent_mutation | Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0709147678 | G -> A | LOC_Os07g15770.1 | downstream_gene_variant ; 4724.0bp to feature; MODIFIER | silent_mutation | Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0709147678 | G -> A | LOC_Os07g15760-LOC_Os07g15770 | intergenic_region ; MODIFIER | silent_mutation | Average:16.809; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709147678 | NA | 3.00E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709147678 | NA | 9.93E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709147678 | NA | 6.07E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709147678 | 1.67E-06 | 9.97E-07 | mr1657_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709147678 | NA | 5.14E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709147678 | NA | 4.81E-31 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |