Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709134172:

Variant ID: vg0709134172 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9134172
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAATTTTGTGCTTTGTTCCTGCTTGTTATATGGAGTTTATTAGAGTAAAAGCCTTTTCTTTTCCGTTGGTTGTGTAGACGCCGCAGCTTCGGAAGATCC[G/A]
CTCTTCGTGGAGGTTGAAGCCGACGTTTGGGAAAGCGAGCAAGACAAGTCACATCATCCTGGAACATATTGAATCCCAGTTTACAAAATTATTTTGATTT

Reverse complement sequence

AAATCAAAATAATTTTGTAAACTGGGATTCAATATGTTCCAGGATGATGTGACTTGTCTTGCTCGCTTTCCCAAACGTCGGCTTCAACCTCCACGAAGAG[C/T]
GGATCTTCCGAAGCTGCGGCGTCTACACAACCAACGGAAAAGAAAAGGCTTTTACTCTAATAAACTCCATATAACAAGCAGGAACAAAGCACAAAATTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.60%	3.40%	10.96%	49.03%	NA
All Indica	2759	6.10%	0.40%	16.09%	77.35%	NA
All Japonica	1512	93.70%	0.50%	1.19%	4.63%	NA
Aus	269	16.00%	51.30%	13.38%	19.33%	NA
Indica I	595	5.20%	0.00%	10.08%	84.71%	NA
Indica II	465	7.10%	0.00%	9.68%	83.23%	NA
Indica III	913	4.50%	0.00%	21.25%	74.26%	NA
Indica Intermediate	786	8.10%	1.50%	18.45%	71.88%	NA
Temperate Japonica	767	96.70%	0.00%	0.26%	3.00%	NA
Tropical Japonica	504	88.50%	0.20%	2.98%	8.33%	NA
Japonica Intermediate	241	94.60%	2.90%	0.41%	2.07%	NA
VI/Aromatic	96	65.60%	0.00%	14.58%	19.79%	NA
Intermediate	90	45.60%	1.10%	6.67%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709134172	G -> DEL	N	N	silent_mutation	Average:4.825; most accessible tissue: Callus, score: 8.41	N	N	N	N
vg0709134172	G -> A	LOC_Os07g15720.1	upstream_gene_variant ; 2758.0bp to feature; MODIFIER	silent_mutation	Average:4.825; most accessible tissue: Callus, score: 8.41	N	N	N	N
vg0709134172	G -> A	LOC_Os07g15740.1	upstream_gene_variant ; 4096.0bp to feature; MODIFIER	silent_mutation	Average:4.825; most accessible tissue: Callus, score: 8.41	N	N	N	N
vg0709134172	G -> A	LOC_Os07g15710.1	downstream_gene_variant ; 2377.0bp to feature; MODIFIER	silent_mutation	Average:4.825; most accessible tissue: Callus, score: 8.41	N	N	N	N
vg0709134172	G -> A	LOC_Os07g15730.1	downstream_gene_variant ; 3465.0bp to feature; MODIFIER	silent_mutation	Average:4.825; most accessible tissue: Callus, score: 8.41	N	N	N	N
vg0709134172	G -> A	LOC_Os07g15710-LOC_Os07g15720	intergenic_region ; MODIFIER	silent_mutation	Average:4.825; most accessible tissue: Callus, score: 8.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709134172	5.09E-06	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	NA	3.81E-17	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	9.35E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	7.51E-06	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	NA	9.92E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	NA	9.32E-46	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	1.27E-06	NA	mr1622_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	NA	1.96E-28	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	NA	9.30E-08	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709134172	1.57E-06	NA	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251