Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709099871:

Variant ID: vg0709099871 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9099871
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATATGCTTTCTCATTTTCCCATTAGCTATACGCTTACACTTACAACTGTTTGGATTGTCCCACACCTGGTCAATAGTAGTGGCTTTGTGCTTGGATTAGT[T/A]
ATGAGCCGTCTATCTAGTCATTTATGTGGAAAAACTGTTAGGTCTTGTAGGTATTACAGCCTCTTTATGAATGAAACAGATCAAAAATTCAAGATGTGGC

Reverse complement sequence

GCCACATCTTGAATTTTTGATCTGTTTCATTCATAAAGAGGCTGTAATACCTACAAGACCTAACAGTTTTTCCACATAAATGACTAGATAGACGGCTCAT[A/T]
ACTAATCCAAGCACAAAGCCACTACTATTGACCAGGTGTGGGACAATCCAAACAGTTGTAAGTGTAAGCGTATAGCTAATGGGAAAATGAGAAAGCATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.00% 0.87% 0.00% NA
All Indica  2759 43.70% 54.90% 1.34% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 88.70% 8.60% 2.69% 0.00% NA
Indica II  465 16.30% 82.20% 1.51% 0.00% NA
Indica III  913 21.50% 78.30% 0.22% 0.00% NA
Indica Intermediate  786 51.80% 46.70% 1.53% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709099871 T -> A LOC_Os07g15660.1 downstream_gene_variant ; 4638.0bp to feature; MODIFIER silent_mutation Average:64.671; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N
vg0709099871 T -> A LOC_Os07g15670.1 intron_variant ; MODIFIER silent_mutation Average:64.671; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N
vg0709099871 T -> A LOC_Os07g15670.3 intron_variant ; MODIFIER silent_mutation Average:64.671; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N
vg0709099871 T -> A LOC_Os07g15670.2 intron_variant ; MODIFIER silent_mutation Average:64.671; most accessible tissue: Minghui63 flag leaf, score: 84.42 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0709099871 T A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709099871 NA 6.29E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 1.34E-13 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 5.32E-11 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 1.44E-10 mr1629 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 3.02E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 5.09E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 7.06E-11 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 6.32E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709099871 NA 5.44E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251