\
| Variant ID: vg0709095039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9095039 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAATGTCATTTTGCAAAGTTTATTTGGAGAGCTGTATAGTTCTCTTTTGGTCTTTACCCTCCTAATTGCATATCTCATATTTTTTATGATTGGCTTCTGG[G/A]
GGTAGACAAGAAAAATAGGAAACTTATTCTCATAGGAGCTTCTGTTATATATTGGGCTCTATGGTTGAGTAGGAATGATATGATTTTTGACAAATCACCA
TGGTGATTTGTCAAAAATCATATCATTCCTACTCAACCATAGAGCCCAATATATAACAGAAGCTCCTATGAGAATAAGTTTCCTATTTTTCTTGTCTACC[C/T]
CCAGAAGCCAATCATAAAAAATATGAGATATGCAATTAGGAGGGTAAAGACCAAAAGAGAACTATACAGCTCTCCAAATAAACTTTGCAAAATGACATTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 3.40% | 1.97% | 13.35% | NA |
| All Indica | 2759 | 74.00% | 0.50% | 2.90% | 22.58% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.07% | 0.07% | NA |
| Aus | 269 | 43.50% | 52.40% | 4.09% | 0.00% | NA |
| Indica I | 595 | 21.30% | 0.20% | 8.24% | 70.25% | NA |
| Indica II | 465 | 90.80% | 0.00% | 1.72% | 7.53% | NA |
| Indica III | 913 | 99.50% | 0.10% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 74.60% | 1.40% | 2.93% | 21.12% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 1.10% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709095039 | G -> DEL | N | N | silent_mutation | Average:18.269; most accessible tissue: Callus, score: 25.814 | N | N | N | N |
| vg0709095039 | G -> A | LOC_Os07g15670.1 | upstream_gene_variant ; 4058.0bp to feature; MODIFIER | silent_mutation | Average:18.269; most accessible tissue: Callus, score: 25.814 | N | N | N | N |
| vg0709095039 | G -> A | LOC_Os07g15670.3 | upstream_gene_variant ; 4058.0bp to feature; MODIFIER | silent_mutation | Average:18.269; most accessible tissue: Callus, score: 25.814 | N | N | N | N |
| vg0709095039 | G -> A | LOC_Os07g15670.2 | upstream_gene_variant ; 4058.0bp to feature; MODIFIER | silent_mutation | Average:18.269; most accessible tissue: Callus, score: 25.814 | N | N | N | N |
| vg0709095039 | G -> A | LOC_Os07g15660.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.269; most accessible tissue: Callus, score: 25.814 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709095039 | NA | 1.16E-41 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709095039 | NA | 3.32E-39 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709095039 | 8.13E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709095039 | NA | 7.28E-34 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709095039 | 2.52E-09 | 4.34E-54 | mr1550_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709095039 | NA | 3.58E-31 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |