\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709095039:

Variant ID: vg0709095039 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9095039
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATGTCATTTTGCAAAGTTTATTTGGAGAGCTGTATAGTTCTCTTTTGGTCTTTACCCTCCTAATTGCATATCTCATATTTTTTATGATTGGCTTCTGG[G/A]
GGTAGACAAGAAAAATAGGAAACTTATTCTCATAGGAGCTTCTGTTATATATTGGGCTCTATGGTTGAGTAGGAATGATATGATTTTTGACAAATCACCA

Reverse complement sequence

TGGTGATTTGTCAAAAATCATATCATTCCTACTCAACCATAGAGCCCAATATATAACAGAAGCTCCTATGAGAATAAGTTTCCTATTTTTCTTGTCTACC[C/T]
CCAGAAGCCAATCATAAAAAATATGAGATATGCAATTAGGAGGGTAAAGACCAAAAGAGAACTATACAGCTCTCCAAATAAACTTTGCAAAATGACATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.30% 3.40% 1.97% 13.35% NA
All Indica  2759 74.00% 0.50% 2.90% 22.58% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.07% NA
Aus  269 43.50% 52.40% 4.09% 0.00% NA
Indica I  595 21.30% 0.20% 8.24% 70.25% NA
Indica II  465 90.80% 0.00% 1.72% 7.53% NA
Indica III  913 99.50% 0.10% 0.00% 0.44% NA
Indica Intermediate  786 74.60% 1.40% 2.93% 21.12% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 1.10% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709095039 G -> DEL N N silent_mutation Average:18.269; most accessible tissue: Callus, score: 25.814 N N N N
vg0709095039 G -> A LOC_Os07g15670.1 upstream_gene_variant ; 4058.0bp to feature; MODIFIER silent_mutation Average:18.269; most accessible tissue: Callus, score: 25.814 N N N N
vg0709095039 G -> A LOC_Os07g15670.3 upstream_gene_variant ; 4058.0bp to feature; MODIFIER silent_mutation Average:18.269; most accessible tissue: Callus, score: 25.814 N N N N
vg0709095039 G -> A LOC_Os07g15670.2 upstream_gene_variant ; 4058.0bp to feature; MODIFIER silent_mutation Average:18.269; most accessible tissue: Callus, score: 25.814 N N N N
vg0709095039 G -> A LOC_Os07g15660.1 intron_variant ; MODIFIER silent_mutation Average:18.269; most accessible tissue: Callus, score: 25.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709095039 NA 1.16E-41 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039 NA 3.32E-39 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039 8.13E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039 NA 7.28E-34 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039 2.52E-09 4.34E-54 mr1550_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709095039 NA 3.58E-31 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251