Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708983069:

Variant ID: vg0708983069 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8983069
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAATTGTGAATTGAAGGGGGTCATTTAAATCATTTTTGCTGCCTTGACTGCTGTCTGGTCATTTGGCCAGAAGTTCCGGGTCCTGTGATCTGGAAGTTC[T/C]
GGCCAAGCAGATTCCCTCCCTATTATCTATCTCTCTATGGACATGTAATCGTATTCTATTATGGTTGGATGTAATGACTGTTAGATGTTTTATTATCCTT

Reverse complement sequence

AAGGATAATAAAACATCTAACAGTCATTACATCCAACCATAATAGAATACGATTACATGTCCATAGAGAGATAGATAATAGGGAGGGAATCTGCTTGGCC[A/G]
GAACTTCCAGATCACAGGACCCGGAACTTCTGGCCAAATGACCAGACAGCAGTCAAGGCAGCAAAAATGATTTAAATGACCCCCTTCAATTCACAATTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.40%	40.20%	11.53%	5.92%	NA
All Indica	2759	65.60%	6.00%	19.14%	9.28%	NA
All Japonica	1512	4.20%	95.20%	0.00%	0.53%	NA
Aus	269	32.00%	65.10%	1.49%	1.49%	NA
Indica I	595	88.90%	1.70%	4.87%	4.54%	NA
Indica II	465	65.40%	7.30%	15.70%	11.61%	NA
Indica III	913	51.80%	0.90%	36.14%	11.17%	NA
Indica Intermediate	786	64.10%	14.40%	12.21%	9.29%	NA
Temperate Japonica	767	0.40%	99.10%	0.00%	0.52%	NA
Tropical Japonica	504	11.30%	88.30%	0.00%	0.40%	NA
Japonica Intermediate	241	1.70%	97.50%	0.00%	0.83%	NA
VI/Aromatic	96	21.90%	76.00%	2.08%	0.00%	NA
Intermediate	90	24.40%	50.00%	12.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708983069	T -> DEL	N	N	silent_mutation	Average:29.571; most accessible tissue: Callus, score: 51.123	N	N	N	N
vg0708983069	T -> C	LOC_Os07g15470.1	downstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Callus, score: 51.123	N	N	N	N
vg0708983069	T -> C	LOC_Os07g15480.1	downstream_gene_variant ; 157.0bp to feature; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Callus, score: 51.123	N	N	N	N
vg0708983069	T -> C	LOC_Os07g15480-LOC_Os07g15490	intergenic_region ; MODIFIER	silent_mutation	Average:29.571; most accessible tissue: Callus, score: 51.123	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708983069	NA	2.01E-22	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	9.96E-23	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	5.84E-42	mr1200	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	6.82E-50	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	1.11E-15	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	9.25E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	5.38E-12	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	4.99E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	8.62E-14	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	2.11E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	2.54E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	2.78E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	2.43E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	1.34E-25	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	4.84E-08	mr1074_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	4.80E-06	mr1148_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	7.46E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	2.92E-27	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	3.48E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	3.27E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	1.00E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	3.53E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	9.83E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	3.14E-06	mr1849_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	3.14E-29	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	NA	6.36E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069	3.27E-06	3.27E-06	mr1947_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251