\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708983069:

Variant ID: vg0708983069 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8983069
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATTGTGAATTGAAGGGGGTCATTTAAATCATTTTTGCTGCCTTGACTGCTGTCTGGTCATTTGGCCAGAAGTTCCGGGTCCTGTGATCTGGAAGTTC[T/C]
GGCCAAGCAGATTCCCTCCCTATTATCTATCTCTCTATGGACATGTAATCGTATTCTATTATGGTTGGATGTAATGACTGTTAGATGTTTTATTATCCTT

Reverse complement sequence

AAGGATAATAAAACATCTAACAGTCATTACATCCAACCATAATAGAATACGATTACATGTCCATAGAGAGATAGATAATAGGGAGGGAATCTGCTTGGCC[A/G]
GAACTTCCAGATCACAGGACCCGGAACTTCTGGCCAAATGACCAGACAGCAGTCAAGGCAGCAAAAATGATTTAAATGACCCCCTTCAATTCACAATTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 40.20% 11.53% 5.92% NA
All Indica  2759 65.60% 6.00% 19.14% 9.28% NA
All Japonica  1512 4.20% 95.20% 0.00% 0.53% NA
Aus  269 32.00% 65.10% 1.49% 1.49% NA
Indica I  595 88.90% 1.70% 4.87% 4.54% NA
Indica II  465 65.40% 7.30% 15.70% 11.61% NA
Indica III  913 51.80% 0.90% 36.14% 11.17% NA
Indica Intermediate  786 64.10% 14.40% 12.21% 9.29% NA
Temperate Japonica  767 0.40% 99.10% 0.00% 0.52% NA
Tropical Japonica  504 11.30% 88.30% 0.00% 0.40% NA
Japonica Intermediate  241 1.70% 97.50% 0.00% 0.83% NA
VI/Aromatic  96 21.90% 76.00% 2.08% 0.00% NA
Intermediate  90 24.40% 50.00% 12.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708983069 T -> DEL N N silent_mutation Average:29.571; most accessible tissue: Callus, score: 51.123 N N N N
vg0708983069 T -> C LOC_Os07g15470.1 downstream_gene_variant ; 2711.0bp to feature; MODIFIER silent_mutation Average:29.571; most accessible tissue: Callus, score: 51.123 N N N N
vg0708983069 T -> C LOC_Os07g15480.1 downstream_gene_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:29.571; most accessible tissue: Callus, score: 51.123 N N N N
vg0708983069 T -> C LOC_Os07g15480-LOC_Os07g15490 intergenic_region ; MODIFIER silent_mutation Average:29.571; most accessible tissue: Callus, score: 51.123 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708983069 NA 2.01E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 9.96E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 5.84E-42 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 6.82E-50 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 1.11E-15 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 9.25E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 5.38E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 4.99E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 8.62E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 2.11E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 2.54E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 2.78E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 2.43E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 1.34E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 4.84E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 4.80E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 7.46E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 2.92E-27 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 3.48E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 3.27E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 1.00E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 3.53E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 9.83E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 3.14E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 3.14E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 NA 6.36E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708983069 3.27E-06 3.27E-06 mr1947_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251