\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708794274:

Variant ID: vg0708794274 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8794274
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTCTGTGCTGAACAATTGGCATCTGTGATTATTGGTTTTGATATTTGGAGATTATCGTCGAAGTGGTTTTGGAGATAATAAATTTTCAGGTGATGAT[C/T]
GGATTCGCTGTTATTTTATGTGACCAGTCTGACCGGGTGGTATATGCCGGTCAGACCGGCGTTTATCAAGCGGTCAGATCGACCGGCCGGCCAGTGGTCT

Reverse complement sequence

AGACCACTGGCCGGCCGGTCGATCTGACCGCTTGATAAACGCCGGTCTGACCGGCATATACCACCCGGTCAGACTGGTCACATAAAATAACAGCGAATCC[G/A]
ATCATCACCTGAAAATTTATTATCTCCAAAACCACTTCGACGATAATCTCCAAATATCAAAACCAATAATCACAGATGCCAATTGTTCAGCACAGAATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.70% 13.20% 3.28% 40.80% NA
All Indica  2759 31.30% 0.90% 4.49% 63.28% NA
All Japonica  1512 67.90% 27.50% 0.20% 4.43% NA
Aus  269 7.10% 57.20% 5.95% 29.74% NA
Indica I  595 78.50% 0.30% 1.01% 20.17% NA
Indica II  465 17.20% 2.20% 3.87% 76.77% NA
Indica III  913 3.50% 0.10% 7.12% 89.27% NA
Indica Intermediate  786 36.30% 1.50% 4.45% 57.76% NA
Temperate Japonica  767 95.20% 3.90% 0.26% 0.65% NA
Tropical Japonica  504 15.90% 72.60% 0.20% 11.31% NA
Japonica Intermediate  241 89.60% 8.30% 0.00% 2.07% NA
VI/Aromatic  96 74.00% 14.60% 7.29% 4.17% NA
Intermediate  90 41.10% 18.90% 5.56% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708794274 C -> DEL N N silent_mutation Average:13.555; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0708794274 C -> T LOC_Os07g15260.1 upstream_gene_variant ; 3042.0bp to feature; MODIFIER silent_mutation Average:13.555; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N
vg0708794274 C -> T LOC_Os07g15250.1 intron_variant ; MODIFIER silent_mutation Average:13.555; most accessible tissue: Zhenshan97 flag leaf, score: 35.167 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708794274 NA 5.31E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 4.51E-07 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 6.78E-08 NA mr1082 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 9.55E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 6.75E-10 4.71E-23 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 1.11E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 4.13E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 2.95E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 3.64E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 4.83E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 1.56E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 1.09E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 7.85E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 3.16E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 3.58E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 3.98E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 2.66E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 6.25E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 4.69E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 6.79E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 3.49E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708794274 NA 1.52E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251