\
| Variant ID: vg0708765167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 8765167 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TACTGCCAGGATGAATGGCATACTGAGTTTGATGAGCTTCTGTCAGTATCAAGTCCTTTAACTTTAACTCTTTGTTTTCAGGTACACACAATCTTTCTCC[T/C]
ATCCAGATTGTTCCTTGTTCATCCTCAACAAAACCTCGGGCTTTTCCAACTCTCATGTTCTTTTTGAGCTCTCTATTTCAGGATCACTTGCTTGAGCTAT
ATAGCTCAAGCAAGTGATCCTGAAATAGAGAGCTCAAAAAGAACATGAGAGTTGGAAAAGCCCGAGGTTTTGTTGAGGATGAACAAGGAACAATCTGGAT[A/G]
GGAGAAAGATTGTGTGTACCTGAAAACAAAGAGTTAAAGTTAAAGGACTTGATACTGACAGAAGCTCATCAAACTCAGTATGCCATTCATCCTGGCAGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 6.70% | 3.39% | 50.57% | NA |
| All Indica | 2759 | 7.50% | 4.50% | 3.81% | 84.16% | NA |
| All Japonica | 1512 | 89.30% | 6.20% | 3.17% | 1.32% | NA |
| Aus | 269 | 61.70% | 33.50% | 0.74% | 4.09% | NA |
| Indica I | 595 | 5.40% | 0.20% | 4.87% | 89.58% | NA |
| Indica II | 465 | 9.70% | 0.20% | 1.29% | 88.82% | NA |
| Indica III | 913 | 6.40% | 7.30% | 2.19% | 84.12% | NA |
| Indica Intermediate | 786 | 9.30% | 7.00% | 6.36% | 77.35% | NA |
| Temperate Japonica | 767 | 87.40% | 11.70% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 89.10% | 0.00% | 8.93% | 1.98% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.70% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 89.60% | 2.10% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 56.70% | 5.60% | 3.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0708765167 | T -> DEL | N | N | silent_mutation | Average:9.834; most accessible tissue: Callus, score: 22.566 | N | N | N | N |
| vg0708765167 | T -> C | LOC_Os07g15200.1 | upstream_gene_variant ; 3556.0bp to feature; MODIFIER | silent_mutation | Average:9.834; most accessible tissue: Callus, score: 22.566 | N | N | N | N |
| vg0708765167 | T -> C | LOC_Os07g15210.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.834; most accessible tissue: Callus, score: 22.566 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0708765167 | NA | 5.01E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 2.08E-12 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 1.33E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 2.32E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 4.18E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 3.41E-06 | mr1270_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 1.85E-24 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 3.26E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 3.27E-08 | mr1408_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 1.79E-22 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 3.94E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 3.05E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 2.93E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 7.76E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708765167 | NA | 2.83E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |