\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708709394:

Variant ID: vg0708709394 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8709394
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACCCCATTTTGTTTCCATGCGGTCCATAAGTTAGACTGCACGGAGAAATAGGGGAGAGCGAAGCTGGGTCATCGCCCACACACGAAAATCAATTTTCG[T/C]
GTGCGGGTCACTTAACAGGCCCGCACGCAAAAATAGGTTATTTTCGCGTGCGGGCCTCCTAATCCACCAGCGCAGGAAAATAGGCTTCCCTCCCATCCTA

Reverse complement sequence

TAGGATGGGAGGGAAGCCTATTTTCCTGCGCTGGTGGATTAGGAGGCCCGCACGCGAAAATAACCTATTTTTGCGTGCGGGCCTGTTAAGTGACCCGCAC[A/G]
CGAAAATTGATTTTCGTGTGTGGGCGATGACCCAGCTTCGCTCTCCCCTATTTCTCCGTGCAGTCTAACTTATGGACCGCATGGAAACAAAATGGGGTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 10.30% 1.65% 0.00% NA
All Indica  2759 99.20% 0.70% 0.07% 0.00% NA
All Japonica  1512 74.50% 20.60% 4.83% 0.00% NA
Aus  269 44.20% 55.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 26.80% 59.70% 13.49% 0.00% NA
Japonica Intermediate  241 94.60% 3.70% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708709394 T -> C LOC_Os07g15160.1 upstream_gene_variant ; 3394.0bp to feature; MODIFIER silent_mutation Average:52.339; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0708709394 T -> C LOC_Os07g15160.2 upstream_gene_variant ; 3394.0bp to feature; MODIFIER silent_mutation Average:52.339; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0708709394 T -> C LOC_Os07g15160-LOC_Os07g15170 intergenic_region ; MODIFIER silent_mutation Average:52.339; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708709394 3.92E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 6.49E-08 8.56E-07 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 NA 1.74E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 9.14E-06 1.63E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 4.55E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 6.80E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 NA 2.38E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708709394 NA 1.10E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251