\
| Variant ID: vg0708709394 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 8709394 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCACCCCATTTTGTTTCCATGCGGTCCATAAGTTAGACTGCACGGAGAAATAGGGGAGAGCGAAGCTGGGTCATCGCCCACACACGAAAATCAATTTTCG[T/C]
GTGCGGGTCACTTAACAGGCCCGCACGCAAAAATAGGTTATTTTCGCGTGCGGGCCTCCTAATCCACCAGCGCAGGAAAATAGGCTTCCCTCCCATCCTA
TAGGATGGGAGGGAAGCCTATTTTCCTGCGCTGGTGGATTAGGAGGCCCGCACGCGAAAATAACCTATTTTTGCGTGCGGGCCTGTTAAGTGACCCGCAC[A/G]
CGAAAATTGATTTTCGTGTGTGGGCGATGACCCAGCTTCGCTCTCCCCTATTTCTCCGTGCAGTCTAACTTATGGACCGCATGGAAACAAAATGGGGTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 10.30% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 74.50% | 20.60% | 4.83% | 0.00% | NA |
| Aus | 269 | 44.20% | 55.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 26.80% | 59.70% | 13.49% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 3.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0708709394 | T -> C | LOC_Os07g15160.1 | upstream_gene_variant ; 3394.0bp to feature; MODIFIER | silent_mutation | Average:52.339; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0708709394 | T -> C | LOC_Os07g15160.2 | upstream_gene_variant ; 3394.0bp to feature; MODIFIER | silent_mutation | Average:52.339; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| vg0708709394 | T -> C | LOC_Os07g15160-LOC_Os07g15170 | intergenic_region ; MODIFIER | silent_mutation | Average:52.339; most accessible tissue: Zhenshan97 young leaf, score: 82.539 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0708709394 | 3.92E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | 6.49E-08 | 8.56E-07 | mr1076 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | NA | 1.74E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | 9.14E-06 | 1.63E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | 4.55E-06 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | 6.80E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | NA | 2.38E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708709394 | NA | 1.10E-06 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |