\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708681067:

Variant ID: vg0708681067 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8681067
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TCACCGGTCCCTAAACTTGTACCGTTGTGTCATCCCGGTCCCTAAACTCGCAAATCGACCGTTCAGGTCCTCAAACTTGTTTGACTGTGTCATCCCGGTC[C/T]
CTAAACTTGCAGATCACTCGTTTAGGTCCTCCAACTTGTTCAGTTGTGTCGCCCCAATCCCTAAACTTGGATTTGAATATCATCTGGATCAAATAGGACG

Reverse complement sequence

CGTCCTATTTGATCCAGATGATATTCAAATCCAAGTTTAGGGATTGGGGCGACACAACTGAACAAGTTGGAGGACCTAAACGAGTGATCTGCAAGTTTAG[G/A]
GACCGGGATGACACAGTCAAACAAGTTTGAGGACCTGAACGGTCGATTTGCGAGTTTAGGGACCGGGATGACACAACGGTACAAGTTTAGGGACCGGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 41.70% 8.99% 3.51% NA
All Indica  2759 11.70% 67.10% 15.19% 5.98% NA
All Japonica  1512 95.20% 4.70% 0.07% 0.00% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 1.30% 72.80% 18.15% 7.73% NA
Indica II  465 9.50% 75.70% 9.46% 5.38% NA
Indica III  913 18.20% 58.60% 18.40% 4.82% NA
Indica Intermediate  786 13.40% 67.70% 12.60% 6.36% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 88.10% 11.70% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 56.70% 38.90% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708681067 C -> DEL N N silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0708681067 C -> T LOC_Os07g15130.1 upstream_gene_variant ; 527.0bp to feature; MODIFIER silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0708681067 C -> T LOC_Os07g15120.1 downstream_gene_variant ; 4585.0bp to feature; MODIFIER silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0708681067 C -> T LOC_Os07g15120-LOC_Os07g15130 intergenic_region ; MODIFIER silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708681067 NA 2.39E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 3.34E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 7.19E-28 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 2.18E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 5.67E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 1.04E-06 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 2.36E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 1.69E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 1.49E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 7.19E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 3.52E-15 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 9.76E-06 3.37E-17 mr1326_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 4.75E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 5.73E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 1.67E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 1.92E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 3.88E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 6.02E-06 2.61E-11 mr1690_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708681067 NA 7.64E-17 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251