Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708524273:

Variant ID: vg0708524273 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8524273
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTCCATATCCATACCTGTTTTCAAAAATTTTAAGGCCATATAATAAACACTAAATCTCCCAACCCTATCCAAAATAGTATACTACTGTAAGACATCT[C/A]
AATTTTTTTCCTCTGGAGGGGGGGGGGGGGGGCTACTCATTTTGAAATGGCTAGAGATTTCTTTGAGTGAACACAATCCAAAGTCTCCCAACCCTATCCC

Reverse complement sequence

GGGATAGGGTTGGGAGACTTTGGATTGTGTTCACTCAAAGAAATCTCTAGCCATTTCAAAATGAGTAGCCCCCCCCCCCCCCCTCCAGAGGAAAAAAATT[G/T]
AGATGTCTTACAGTAGTATACTATTTTGGATAGGGTTGGGAGATTTAGTGTTTATTATATGGCCTTAAAATTTTTGAAAACAGGTATGGATATGGAAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	10.90%	5.33%	0.00%	NA
All Indica	2759	72.90%	18.20%	8.95%	0.00%	NA
All Japonica	1512	99.50%	0.30%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.90%	1.30%	6.72%	0.00%	NA
Indica II	465	43.70%	42.60%	13.76%	0.00%	NA
Indica III	913	70.60%	19.90%	9.42%	0.00%	NA
Indica Intermediate	786	78.20%	14.50%	7.25%	0.00%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708524273	C -> A	LOC_Os07g14890.1	upstream_gene_variant ; 1344.0bp to feature; MODIFIER	silent_mutation	Average:61.976; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0708524273	C -> A	LOC_Os07g14900.1	upstream_gene_variant ; 2377.0bp to feature; MODIFIER	silent_mutation	Average:61.976; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0708524273	C -> A	LOC_Os07g14890.2	upstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:61.976; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg0708524273	C -> A	LOC_Os07g14880-LOC_Os07g14890	intergenic_region ; MODIFIER	silent_mutation	Average:61.976; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708524273	1.97E-06	1.40E-09	mr1113_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708524273	5.62E-07	7.64E-09	mr1114_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708524273	5.09E-07	2.62E-08	mr1117_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708524273	6.18E-06	1.56E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708524273	NA	6.39E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708524273	NA	7.46E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251