Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708399861:

Variant ID: vg0708399861 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8399861
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTGCCATGGATGTGTTTCAATACTGGATGTATTGTCCTGGATAGAAACTACTATTTCAATTCATGCCTGCGCGGGATGGGAACTACTATCTTCTTTGA[C/A]
TTGGTGTTTGGAAAAGTGTTTCCTATCAAAGAAAGAAAGCCTTATGTTCATGCTTTATTGTCAATGATGTGTATATGTGTTTTCTAGTTCTATATTGTAC

Reverse complement sequence

GTACAATATAGAACTAGAAAACACATATACACATCATTGACAATAAAGCATGAACATAAGGCTTTCTTTCTTTGATAGGAAACACTTTTCCAAACACCAA[G/T]
TCAAAGAAGATAGTAGTTCCCATCCCGCGCAGGCATGAATTGAAATAGTAGTTTCTATCCAGGACAATACATCCAGTATTGAAACACATCCATGGCAAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	13.80%	2.05%	0.00%	NA
All Indica	2759	97.30%	0.80%	1.92%	0.00%	NA
All Japonica	1512	71.30%	26.70%	1.98%	0.00%	NA
Aus	269	41.30%	56.10%	2.60%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	97.40%	2.20%	0.43%	0.00%	NA
Indica III	913	99.60%	0.00%	0.44%	0.00%	NA
Indica Intermediate	786	92.90%	1.40%	5.73%	0.00%	NA
Temperate Japonica	767	95.20%	2.20%	2.61%	0.00%	NA
Tropical Japonica	504	30.20%	68.70%	1.19%	0.00%	NA
Japonica Intermediate	241	81.30%	17.00%	1.66%	0.00%	NA
VI/Aromatic	96	30.20%	66.70%	3.12%	0.00%	NA
Intermediate	90	80.00%	15.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708399861	C -> A	LOC_Os07g14720-LOC_Os07g14740	intergenic_region ; MODIFIER	silent_mutation	Average:40.16; most accessible tissue: Zhenshan97 flower, score: 53.595	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708399861	2.67E-06	2.66E-06	mr1802	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	NA	8.33E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	4.18E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	NA	4.38E-13	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	NA	3.82E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	NA	5.86E-17	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	NA	1.70E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708399861	NA	7.61E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251