\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708379053:

Variant ID: vg0708379053 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8379053
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATCCCTTGAAAAAATTCTTATGATTGAAGTGTGCATATAATTTTTTTCTCCATTTTTTATTTCTATGTGCTAAAATCTATCTATCTATCTATTATATA[C/T]
TAAAAGTCCATTAAACTTCCTACAAACGCTCTTAAGCCACCACGTGGCACTCCTACAAACTCTCCTAAGTCGCCACATGGCACAATCTAATCTCACCGTC

Reverse complement sequence

GACGGTGAGATTAGATTGTGCCATGTGGCGACTTAGGAGAGTTTGTAGGAGTGCCACGTGGTGGCTTAAGAGCGTTTGTAGGAAGTTTAATGGACTTTTA[G/A]
TATATAATAGATAGATAGATAGATTTTAGCACATAGAAATAAAAAATGGAGAAAAAAATTATATGCACACTTCAATCATAAGAATTTTTTCAAGGGATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 13.00% 18.03% 0.76% NA
All Indica  2759 49.80% 21.70% 27.36% 1.20% NA
All Japonica  1512 95.70% 0.30% 3.97% 0.00% NA
Aus  269 95.90% 0.40% 3.72% 0.00% NA
Indica I  595 23.50% 33.60% 42.35% 0.50% NA
Indica II  465 67.50% 9.50% 19.78% 3.23% NA
Indica III  913 58.90% 21.20% 19.61% 0.22% NA
Indica Intermediate  786 48.50% 20.40% 29.52% 1.65% NA
Temperate Japonica  767 99.60% 0.00% 0.39% 0.00% NA
Tropical Japonica  504 88.50% 1.00% 10.52% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 1.66% 0.00% NA
VI/Aromatic  96 83.30% 2.10% 11.46% 3.12% NA
Intermediate  90 72.20% 10.00% 17.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708379053 C -> DEL N N silent_mutation Average:38.313; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0708379053 C -> T LOC_Os07g14700.1 downstream_gene_variant ; 2915.0bp to feature; MODIFIER silent_mutation Average:38.313; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0708379053 C -> T LOC_Os07g14680-LOC_Os07g14700 intergenic_region ; MODIFIER silent_mutation Average:38.313; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708379053 NA 8.96E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 1.04E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 3.94E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 5.76E-17 mr1592 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 1.13E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 4.27E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 7.82E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708379053 NA 3.61E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251