\
| Variant ID: vg0708379053 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 8379053 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATCCCTTGAAAAAATTCTTATGATTGAAGTGTGCATATAATTTTTTTCTCCATTTTTTATTTCTATGTGCTAAAATCTATCTATCTATCTATTATATA[C/T]
TAAAAGTCCATTAAACTTCCTACAAACGCTCTTAAGCCACCACGTGGCACTCCTACAAACTCTCCTAAGTCGCCACATGGCACAATCTAATCTCACCGTC
GACGGTGAGATTAGATTGTGCCATGTGGCGACTTAGGAGAGTTTGTAGGAGTGCCACGTGGTGGCTTAAGAGCGTTTGTAGGAAGTTTAATGGACTTTTA[G/A]
TATATAATAGATAGATAGATAGATTTTAGCACATAGAAATAAAAAATGGAGAAAAAAATTATATGCACACTTCAATCATAAGAATTTTTTCAAGGGATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 13.00% | 18.03% | 0.76% | NA |
| All Indica | 2759 | 49.80% | 21.70% | 27.36% | 1.20% | NA |
| All Japonica | 1512 | 95.70% | 0.30% | 3.97% | 0.00% | NA |
| Aus | 269 | 95.90% | 0.40% | 3.72% | 0.00% | NA |
| Indica I | 595 | 23.50% | 33.60% | 42.35% | 0.50% | NA |
| Indica II | 465 | 67.50% | 9.50% | 19.78% | 3.23% | NA |
| Indica III | 913 | 58.90% | 21.20% | 19.61% | 0.22% | NA |
| Indica Intermediate | 786 | 48.50% | 20.40% | 29.52% | 1.65% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 88.50% | 1.00% | 10.52% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 2.10% | 11.46% | 3.12% | NA |
| Intermediate | 90 | 72.20% | 10.00% | 17.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0708379053 | C -> DEL | N | N | silent_mutation | Average:38.313; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0708379053 | C -> T | LOC_Os07g14700.1 | downstream_gene_variant ; 2915.0bp to feature; MODIFIER | silent_mutation | Average:38.313; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0708379053 | C -> T | LOC_Os07g14680-LOC_Os07g14700 | intergenic_region ; MODIFIER | silent_mutation | Average:38.313; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0708379053 | NA | 8.96E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 1.04E-18 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 3.94E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 5.76E-17 | mr1592 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 1.13E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 4.27E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 7.82E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708379053 | NA | 3.61E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |