\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708363931:

Variant ID: vg0708363931 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8363931
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


ATCACGCCCACCCTCGCCACCGGTGCTTAGGAAAGGGTCGAGCTATACTTCAGATCAAGCAGTTACCCACTCCCGCTTGTGGTAAGCATGGTAAGTCTCC[T/C]
AGGGTTTCTCATGAACCGGTCCTTAATTGCCATGGGTGCGACCAGCAAAACCATGCACCCACAGCCCACCATTTAGTGTATTTTAATTAACTAACACCAT

Reverse complement sequence

ATGGTGTTAGTTAATTAAAATACACTAAATGGTGGGCTGTGGGTGCATGGTTTTGCTGGTCGCACCCATGGCAATTAAGGACCGGTTCATGAGAAACCCT[A/G]
GGAGACTTACCATGCTTACCACAAGCGGGAGTGGGTAACTGCTTGATCTGAAGTATAGCTCGACCCTTTCCTAAGCACCGGTGGCGAGGGTGGGCGTGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.00% 9.50% 13.67% 39.84% NA
All Indica  2759 5.30% 6.00% 22.62% 66.11% NA
All Japonica  1512 87.20% 11.80% 0.13% 0.86% NA
Aus  269 60.60% 34.90% 0.74% 3.72% NA
Indica I  595 3.50% 2.00% 16.64% 77.82% NA
Indica II  465 6.70% 1.30% 15.05% 76.99% NA
Indica III  913 4.60% 9.30% 29.03% 57.06% NA
Indica Intermediate  786 6.60% 7.90% 24.17% 61.32% NA
Temperate Japonica  767 83.60% 15.40% 0.00% 1.04% NA
Tropical Japonica  504 88.70% 10.90% 0.20% 0.20% NA
Japonica Intermediate  241 95.40% 2.50% 0.41% 1.66% NA
VI/Aromatic  96 79.20% 1.00% 11.46% 8.33% NA
Intermediate  90 50.00% 11.10% 7.78% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708363931 T -> DEL N N silent_mutation Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0708363931 T -> C LOC_Os07g14660.1 upstream_gene_variant ; 4726.0bp to feature; MODIFIER silent_mutation Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0708363931 T -> C LOC_Os07g14670.1 upstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N
vg0708363931 T -> C LOC_Os07g14680.1 intron_variant ; MODIFIER silent_mutation Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708363931 NA 1.81E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708363931 8.96E-06 NA mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708363931 NA 7.09E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708363931 2.94E-06 NA mr1496_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251