RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0708363931:

Variant ID: vg0708363931 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8363931
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

ATCACGCCCACCCTCGCCACCGGTGCTTAGGAAAGGGTCGAGCTATACTTCAGATCAAGCAGTTACCCACTCCCGCTTGTGGTAAGCATGGTAAGTCTCC[T/C]
AGGGTTTCTCATGAACCGGTCCTTAATTGCCATGGGTGCGACCAGCAAAACCATGCACCCACAGCCCACCATTTAGTGTATTTTAATTAACTAACACCAT

Reverse complement sequence

ATGGTGTTAGTTAATTAAAATACACTAAATGGTGGGCTGTGGGTGCATGGTTTTGCTGGTCGCACCCATGGCAATTAAGGACCGGTTCATGAGAAACCCT[A/G]
GGAGACTTACCATGCTTACCACAAGCGGGAGTGGGTAACTGCTTGATCTGAAGTATAGCTCGACCCTTTCCTAAGCACCGGTGGCGAGGGTGGGCGTGAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.00%	9.50%	13.67%	39.84%	NA
All Indica	2759	5.30%	6.00%	22.62%	66.11%	NA
All Japonica	1512	87.20%	11.80%	0.13%	0.86%	NA
Aus	269	60.60%	34.90%	0.74%	3.72%	NA
Indica I	595	3.50%	2.00%	16.64%	77.82%	NA
Indica II	465	6.70%	1.30%	15.05%	76.99%	NA
Indica III	913	4.60%	9.30%	29.03%	57.06%	NA
Indica Intermediate	786	6.60%	7.90%	24.17%	61.32%	NA
Temperate Japonica	767	83.60%	15.40%	0.00%	1.04%	NA
Tropical Japonica	504	88.70%	10.90%	0.20%	0.20%	NA
Japonica Intermediate	241	95.40%	2.50%	0.41%	1.66%	NA
VI/Aromatic	96	79.20%	1.00%	11.46%	8.33%	NA
Intermediate	90	50.00%	11.10%	7.78%	31.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708363931	T -> DEL	N	N	silent_mutation	Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872	N	N	N	N
vg0708363931	T -> C	LOC_Os07g14660.1	upstream_gene_variant ; 4726.0bp to feature; MODIFIER	silent_mutation	Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872	N	N	N	N
vg0708363931	T -> C	LOC_Os07g14670.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872	N	N	N	N
vg0708363931	T -> C	LOC_Os07g14680.1	intron_variant ; MODIFIER	silent_mutation	Average:35.505; most accessible tissue: Zhenshan97 flower, score: 61.872	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708363931	NA	1.81E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708363931	8.96E-06	NA	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708363931	NA	7.09E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708363931	2.94E-06	NA	mr1496_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0708363931:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact