\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708308206:

Variant ID: vg0708308206 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8308206
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTTTTTTTGGCCAACCGCCCTCAAAGACGCTTGCGACATGGTTCAGCGGTGTGAGGCCTGTCAATATCACAGTAAACACACAAAGCTACTAGCGCAAA[T/C]
GCTCCAGACTATCCCTCTTACTTGGCCGTTCTCGTGCTAGGGACTCGACATACTTGAACCATTCCCACGAGGACAGGGCGGCTACAGATTCCTATTCGTG

Reverse complement sequence

CACGAATAGGAATCTGTAGCCGCCCTGTCCTCGTGGGAATGGTTCAAGTATGTCGAGTCCCTAGCACGAGAACGGCCAAGTAAGAGGGATAGTCTGGAGC[A/G]
TTTGCGCTAGTAGCTTTGTGTGTTTACTGTGATATTGACAGGCCTCACACCGCTGAACCATGTCGCAAGCGTCTTTGAGGGCGGTTGGCCAAAAAAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 34.00% 0.02% 1.76% NA
All Indica  2759 95.20% 1.80% 0.04% 2.97% NA
All Japonica  1512 15.00% 84.90% 0.00% 0.07% NA
Aus  269 41.30% 58.70% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.00% 0.50% NA
Indica II  465 93.10% 5.40% 0.00% 1.51% NA
Indica III  913 99.50% 0.20% 0.00% 0.33% NA
Indica Intermediate  786 88.40% 2.70% 0.13% 8.78% NA
Temperate Japonica  767 17.50% 82.40% 0.00% 0.13% NA
Tropical Japonica  504 12.50% 87.50% 0.00% 0.00% NA
Japonica Intermediate  241 12.40% 87.60% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708308206 T -> DEL N N silent_mutation Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0708308206 T -> C LOC_Os07g14560.1 downstream_gene_variant ; 836.0bp to feature; MODIFIER silent_mutation Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0708308206 T -> C LOC_Os07g14570.1 downstream_gene_variant ; 92.0bp to feature; MODIFIER silent_mutation Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0708308206 T -> C LOC_Os07g14560-LOC_Os07g14570 intergenic_region ; MODIFIER silent_mutation Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708308206 NA 6.15E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 2.50E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 2.57E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 2.41E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 3.76E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 2.61E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 1.07E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 7.44E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 1.70E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 NA 8.56E-06 mr1872_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206 1.83E-06 NA mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251