Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708308206:

Variant ID: vg0708308206 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8308206
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTTTTTTTGGCCAACCGCCCTCAAAGACGCTTGCGACATGGTTCAGCGGTGTGAGGCCTGTCAATATCACAGTAAACACACAAAGCTACTAGCGCAAA[T/C]
GCTCCAGACTATCCCTCTTACTTGGCCGTTCTCGTGCTAGGGACTCGACATACTTGAACCATTCCCACGAGGACAGGGCGGCTACAGATTCCTATTCGTG

Reverse complement sequence

CACGAATAGGAATCTGTAGCCGCCCTGTCCTCGTGGGAATGGTTCAAGTATGTCGAGTCCCTAGCACGAGAACGGCCAAGTAAGAGGGATAGTCTGGAGC[A/G]
TTTGCGCTAGTAGCTTTGTGTGTTTACTGTGATATTGACAGGCCTCACACCGCTGAACCATGTCGCAAGCGTCTTTGAGGGCGGTTGGCCAAAAAAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	34.00%	0.02%	1.76%	NA
All Indica	2759	95.20%	1.80%	0.04%	2.97%	NA
All Japonica	1512	15.00%	84.90%	0.00%	0.07%	NA
Aus	269	41.30%	58.70%	0.00%	0.00%	NA
Indica I	595	99.20%	0.30%	0.00%	0.50%	NA
Indica II	465	93.10%	5.40%	0.00%	1.51%	NA
Indica III	913	99.50%	0.20%	0.00%	0.33%	NA
Indica Intermediate	786	88.40%	2.70%	0.13%	8.78%	NA
Temperate Japonica	767	17.50%	82.40%	0.00%	0.13%	NA
Tropical Japonica	504	12.50%	87.50%	0.00%	0.00%	NA
Japonica Intermediate	241	12.40%	87.60%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708308206	T -> DEL	N	N	silent_mutation	Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0708308206	T -> C	LOC_Os07g14560.1	downstream_gene_variant ; 836.0bp to feature; MODIFIER	silent_mutation	Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0708308206	T -> C	LOC_Os07g14570.1	downstream_gene_variant ; 92.0bp to feature; MODIFIER	silent_mutation	Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0708308206	T -> C	LOC_Os07g14560-LOC_Os07g14570	intergenic_region ; MODIFIER	silent_mutation	Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708308206	NA	6.15E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	2.50E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	2.57E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	2.41E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	3.76E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	2.61E-09	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	1.07E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	7.44E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	1.70E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	NA	8.56E-06	mr1872_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708308206	1.83E-06	NA	mr1914_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251