\
| Variant ID: vg0708308206 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 8308206 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTTTTTTTTGGCCAACCGCCCTCAAAGACGCTTGCGACATGGTTCAGCGGTGTGAGGCCTGTCAATATCACAGTAAACACACAAAGCTACTAGCGCAAA[T/C]
GCTCCAGACTATCCCTCTTACTTGGCCGTTCTCGTGCTAGGGACTCGACATACTTGAACCATTCCCACGAGGACAGGGCGGCTACAGATTCCTATTCGTG
CACGAATAGGAATCTGTAGCCGCCCTGTCCTCGTGGGAATGGTTCAAGTATGTCGAGTCCCTAGCACGAGAACGGCCAAGTAAGAGGGATAGTCTGGAGC[A/G]
TTTGCGCTAGTAGCTTTGTGTGTTTACTGTGATATTGACAGGCCTCACACCGCTGAACCATGTCGCAAGCGTCTTTGAGGGCGGTTGGCCAAAAAAAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 34.00% | 0.02% | 1.76% | NA |
| All Indica | 2759 | 95.20% | 1.80% | 0.04% | 2.97% | NA |
| All Japonica | 1512 | 15.00% | 84.90% | 0.00% | 0.07% | NA |
| Aus | 269 | 41.30% | 58.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.00% | 0.50% | NA |
| Indica II | 465 | 93.10% | 5.40% | 0.00% | 1.51% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 88.40% | 2.70% | 0.13% | 8.78% | NA |
| Temperate Japonica | 767 | 17.50% | 82.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.40% | 87.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0708308206 | T -> DEL | N | N | silent_mutation | Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0708308206 | T -> C | LOC_Os07g14560.1 | downstream_gene_variant ; 836.0bp to feature; MODIFIER | silent_mutation | Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0708308206 | T -> C | LOC_Os07g14570.1 | downstream_gene_variant ; 92.0bp to feature; MODIFIER | silent_mutation | Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0708308206 | T -> C | LOC_Os07g14560-LOC_Os07g14570 | intergenic_region ; MODIFIER | silent_mutation | Average:54.636; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0708308206 | NA | 6.15E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 2.50E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 2.57E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 2.41E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 3.76E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 2.61E-09 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 1.07E-22 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 7.44E-12 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 1.70E-14 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | NA | 8.56E-06 | mr1872_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708308206 | 1.83E-06 | NA | mr1914_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |