\
| Variant ID: vg0708259470 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 8259470 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 105. )
ACGGAGAGAGAAACGACAATGACGAACTCTGGTGGTGAACCCGGGCGGGTGAGTGCATCAAAACGCGTTCTCAGACGAGGGGATTCCATTTTCTTTGAAC[A/G]
CGCAAGAGGGAGGGAATGCAGGGGAGAAGAGGGGCACTGGGAAGAGCAATGAAGAAAACCAAAATAGTAGGAACAACAACGACATGGTCCCGACGGAGAG
CTCTCCGTCGGGACCATGTCGTTGTTGTTCCTACTATTTTGGTTTTCTTCATTGCTCTTCCCAGTGCCCCTCTTCTCCCCTGCATTCCCTCCCTCTTGCG[T/C]
GTTCAAAGAAAATGGAATCCCCTCGTCTGAGAACGCGTTTTGATGCACTCACCCGCCCGGGTTCACCACCAGAGTTCGTCATTGTCGTTTCTCTCTCCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 34.60% | 3.24% | 1.10% | NA |
| All Indica | 2759 | 92.50% | 2.30% | 3.33% | 1.85% | NA |
| All Japonica | 1512 | 10.60% | 85.40% | 3.90% | 0.07% | NA |
| Aus | 269 | 39.80% | 59.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 90.80% | 1.00% | 7.23% | 1.01% | NA |
| Indica II | 465 | 92.50% | 5.80% | 0.65% | 1.08% | NA |
| Indica III | 913 | 97.80% | 0.40% | 1.10% | 0.66% | NA |
| Indica Intermediate | 786 | 87.80% | 3.30% | 4.58% | 4.33% | NA |
| Temperate Japonica | 767 | 9.50% | 82.90% | 7.43% | 0.13% | NA |
| Tropical Japonica | 504 | 11.70% | 88.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.60% | 87.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 51.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0708259470 | A -> DEL | N | N | silent_mutation | Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0708259470 | A -> G | LOC_Os07g14490.1 | downstream_gene_variant ; 1218.0bp to feature; MODIFIER | silent_mutation | Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg0708259470 | A -> G | LOC_Os07g14500.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0708259470 | NA | 7.28E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 5.48E-13 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 1.88E-17 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 2.91E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 4.10E-32 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 1.59E-22 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 8.81E-26 | mr1551_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 1.38E-14 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 9.28E-13 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708259470 | NA | 6.19E-06 | mr1852_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |