Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708259470:

Variant ID: vg0708259470 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8259470
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ACGGAGAGAGAAACGACAATGACGAACTCTGGTGGTGAACCCGGGCGGGTGAGTGCATCAAAACGCGTTCTCAGACGAGGGGATTCCATTTTCTTTGAAC[A/G]
CGCAAGAGGGAGGGAATGCAGGGGAGAAGAGGGGCACTGGGAAGAGCAATGAAGAAAACCAAAATAGTAGGAACAACAACGACATGGTCCCGACGGAGAG

Reverse complement sequence

CTCTCCGTCGGGACCATGTCGTTGTTGTTCCTACTATTTTGGTTTTCTTCATTGCTCTTCCCAGTGCCCCTCTTCTCCCCTGCATTCCCTCCCTCTTGCG[T/C]
GTTCAAAGAAAATGGAATCCCCTCGTCTGAGAACGCGTTTTGATGCACTCACCCGCCCGGGTTCACCACCAGAGTTCGTCATTGTCGTTTCTCTCTCCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	34.60%	3.24%	1.10%	NA
All Indica	2759	92.50%	2.30%	3.33%	1.85%	NA
All Japonica	1512	10.60%	85.40%	3.90%	0.07%	NA
Aus	269	39.80%	59.50%	0.74%	0.00%	NA
Indica I	595	90.80%	1.00%	7.23%	1.01%	NA
Indica II	465	92.50%	5.80%	0.65%	1.08%	NA
Indica III	913	97.80%	0.40%	1.10%	0.66%	NA
Indica Intermediate	786	87.80%	3.30%	4.58%	4.33%	NA
Temperate Japonica	767	9.50%	82.90%	7.43%	0.13%	NA
Tropical Japonica	504	11.70%	88.30%	0.00%	0.00%	NA
Japonica Intermediate	241	11.60%	87.60%	0.83%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708259470	A -> DEL	N	N	silent_mutation	Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05	N	N	N	N
vg0708259470	A -> G	LOC_Os07g14490.1	downstream_gene_variant ; 1218.0bp to feature; MODIFIER	silent_mutation	Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05	N	N	N	N
vg0708259470	A -> G	LOC_Os07g14500.1	intron_variant ; MODIFIER	silent_mutation	Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708259470	NA	7.28E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	5.48E-13	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	1.88E-17	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	2.91E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	4.10E-32	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	1.59E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	8.81E-26	mr1551_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	1.38E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	9.28E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470	NA	6.19E-06	mr1852_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251