\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708259470:

Variant ID: vg0708259470 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8259470
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGAGAGAGAAACGACAATGACGAACTCTGGTGGTGAACCCGGGCGGGTGAGTGCATCAAAACGCGTTCTCAGACGAGGGGATTCCATTTTCTTTGAAC[A/G]
CGCAAGAGGGAGGGAATGCAGGGGAGAAGAGGGGCACTGGGAAGAGCAATGAAGAAAACCAAAATAGTAGGAACAACAACGACATGGTCCCGACGGAGAG

Reverse complement sequence

CTCTCCGTCGGGACCATGTCGTTGTTGTTCCTACTATTTTGGTTTTCTTCATTGCTCTTCCCAGTGCCCCTCTTCTCCCCTGCATTCCCTCCCTCTTGCG[T/C]
GTTCAAAGAAAATGGAATCCCCTCGTCTGAGAACGCGTTTTGATGCACTCACCCGCCCGGGTTCACCACCAGAGTTCGTCATTGTCGTTTCTCTCTCCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 34.60% 3.24% 1.10% NA
All Indica  2759 92.50% 2.30% 3.33% 1.85% NA
All Japonica  1512 10.60% 85.40% 3.90% 0.07% NA
Aus  269 39.80% 59.50% 0.74% 0.00% NA
Indica I  595 90.80% 1.00% 7.23% 1.01% NA
Indica II  465 92.50% 5.80% 0.65% 1.08% NA
Indica III  913 97.80% 0.40% 1.10% 0.66% NA
Indica Intermediate  786 87.80% 3.30% 4.58% 4.33% NA
Temperate Japonica  767 9.50% 82.90% 7.43% 0.13% NA
Tropical Japonica  504 11.70% 88.30% 0.00% 0.00% NA
Japonica Intermediate  241 11.60% 87.60% 0.83% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708259470 A -> DEL N N silent_mutation Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0708259470 A -> G LOC_Os07g14490.1 downstream_gene_variant ; 1218.0bp to feature; MODIFIER silent_mutation Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N
vg0708259470 A -> G LOC_Os07g14500.1 intron_variant ; MODIFIER silent_mutation Average:33.178; most accessible tissue: Zhenshan97 root, score: 43.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708259470 NA 7.28E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 5.48E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 1.88E-17 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 2.91E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 4.10E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 1.59E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 8.81E-26 mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 1.38E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 9.28E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708259470 NA 6.19E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251