Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708222929:

Variant ID: vg0708222929 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8222929
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, G: 0.08, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTTGAATTCCCTAGCAAAATAATTTCTATAGGAAAATGGCTTTAAAAACCATATTAATCTACTTTCAAATTTTCTATAAGCTAATAATTAATTAATTA[T/G]
GCGTTAATCCTCGTTTCATTTTGCGTGCTGGGAGGGAAGGGTTCAGAACCCGTAGCGGTCCGAACACACCCAGATTCGGGGTCCACCTCTTTGATTTAAT

Reverse complement sequence

ATTAAATCAAAGAGGTGGACCCCGAATCTGGGTGTGTTCGGACCGCTACGGGTTCTGAACCCTTCCCTCCCAGCACGCAAAATGAAACGAGGATTAACGC[A/C]
TAATTAATTAATTATTAGCTTATAGAAAATTTGAAAGTAGATTAATATGGTTTTTAAAGCCATTTTCCTATAGAAATTATTTTGCTAGGGAATTCAAGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	38.60%	1.14%	0.63%	NA
All Indica	2759	94.20%	2.80%	1.96%	1.05%	NA
All Japonica	1512	4.30%	95.60%	0.00%	0.07%	NA
Aus	269	40.90%	59.10%	0.00%	0.00%	NA
Indica I	595	98.70%	0.80%	0.17%	0.34%	NA
Indica II	465	92.70%	5.60%	1.29%	0.43%	NA
Indica III	913	98.20%	1.40%	0.22%	0.11%	NA
Indica Intermediate	786	86.90%	4.30%	5.73%	3.05%	NA
Temperate Japonica	767	0.80%	99.10%	0.00%	0.13%	NA
Tropical Japonica	504	10.70%	89.30%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708222929	T -> DEL	N	N	silent_mutation	Average:18.569; most accessible tissue: Zhenshan97 flower, score: 31.8	N	N	N	N
vg0708222929	T -> G	LOC_Os07g14400.1	upstream_gene_variant ; 2235.0bp to feature; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Zhenshan97 flower, score: 31.8	N	N	N	N
vg0708222929	T -> G	LOC_Os07g14410.1	downstream_gene_variant ; 2413.0bp to feature; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Zhenshan97 flower, score: 31.8	N	N	N	N
vg0708222929	T -> G	LOC_Os07g14400-LOC_Os07g14410	intergenic_region ; MODIFIER	silent_mutation	Average:18.569; most accessible tissue: Zhenshan97 flower, score: 31.8	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708222929	NA	1.20E-28	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.60E-41	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	1.71E-07	1.46E-27	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	9.23E-32	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	5.04E-32	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	6.73E-58	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.04E-36	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	2.68E-32	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	5.59E-43	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	1.48E-06	3.20E-32	mr1145	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.15E-25	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	7.88E-11	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	6.67E-33	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.82E-31	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.74E-28	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.91E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	4.56E-28	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	4.00E-13	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.18E-12	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	2.76E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.00E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.51E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	2.41E-22	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	2.53E-27	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	3.80E-31	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	7.58E-42	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	4.78E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	2.62E-31	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	3.29E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	6.86E-41	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	4.73E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	6.89E-13	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.74E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	6.26E-58	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.37E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	5.26E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	6.73E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	7.43E-12	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	3.35E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	1.34E-13	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708222929	NA	3.04E-77	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251