\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708220481:

Variant ID: vg0708220481 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8220481
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCCGATGGGCTCAACTGCGGGAGCTCCACCTGGAAAAGGCGAAGAATCTCCGGCAACAACGCGTTGCACGGAAACCGGAGCCCCGTCTCAAAAAATAC[G/A]
GCGAACACTCACTGTCCGGTTATCAACGGGCTTCGGTACAACGGCTTTCCCCGGGGCGAAAGCCTGTCCCTCGACTAACGCCCCAGAGCTGACCAACTTT

Reverse complement sequence

AAAGTTGGTCAGCTCTGGGGCGTTAGTCGAGGGACAGGCTTTCGCCCCGGGGAAAGCCGTTGTACCGAAGCCCGTTGATAACCGGACAGTGAGTGTTCGC[C/T]
GTATTTTTTGAGACGGGGCTCCGGTTTCCGTGCAACGCGTTGTTGCCGGAGATTCTTCGCCTTTTCCAGGTGGAGCTCCCGCAGTTGAGCCCATCGGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 6.70% 1.44% 0.87% NA
All Indica  2759 96.60% 0.20% 1.70% 1.45% NA
All Japonica  1512 78.70% 20.00% 1.26% 0.07% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.34% NA
Indica II  465 96.60% 1.10% 1.94% 0.43% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 90.80% 0.10% 4.45% 4.58% NA
Temperate Japonica  767 99.30% 0.30% 0.26% 0.13% NA
Tropical Japonica  504 38.30% 58.70% 2.98% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708220481 G -> DEL N N silent_mutation Average:67.592; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg0708220481 G -> A LOC_Os07g14410.1 downstream_gene_variant ; 4861.0bp to feature; MODIFIER silent_mutation Average:67.592; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg0708220481 G -> A LOC_Os07g14400.1 intron_variant ; MODIFIER silent_mutation Average:67.592; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708220481 2.28E-08 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 3.36E-08 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 NA 7.85E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 8.27E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 2.14E-07 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 9.73E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 2.91E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.14E-09 NA mr1107 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.91E-08 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 NA 7.60E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.37E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 2.00E-06 4.91E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.12E-10 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 NA 1.33E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 9.77E-12 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 NA 1.28E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 4.96E-07 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 2.63E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.41E-09 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 8.50E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.20E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.64E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 NA 2.38E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 1.51E-06 1.98E-12 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708220481 8.23E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251