Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708155828:

Variant ID: vg0708155828 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8155828
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCACTCCATTGCATTATATTGAATCCTTGCAAGAGCTCTCATGCCCTTGTGCACTTTATCTAGTGAGTTAAGATAACCCAAGTGGGCAAGTAGTTACTTT[G/A]
CATGAGCATAAAGCCTCTCTTTTCTACCAAAGCTTCAAAAGCAGAATGGGAGTGTCAACCTTTCCCACAATGGTTTCAAAAAAGACATCTCATGAGACAG

Reverse complement sequence

CTGTCTCATGAGATGTCTTTTTTGAAACCATTGTGGGAAAGGTTGACACTCCCATTCTGCTTTTGAAGCTTTGGTAGAAAAGAGAGGCTTTATGCTCATG[C/T]
AAAGTAACTACTTGCCCACTTGGGTTATCTTAACTCACTAGATAAAGTGCACAAGGGCATGAGAGCTCTTGCAAGGATTCAATATAATGCAATGGAGTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	13.00%	0.32%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	73.50%	26.10%	0.40%	0.00%	NA
Aus	269	43.50%	53.20%	3.35%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	97.30%	2.30%	0.39%	0.00%	NA
Tropical Japonica	504	33.90%	65.70%	0.40%	0.00%	NA
Japonica Intermediate	241	80.50%	19.10%	0.41%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708155828	G -> A	LOC_Os07g14290.1	upstream_gene_variant ; 4970.0bp to feature; MODIFIER	silent_mutation	Average:43.167; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg0708155828	G -> A	LOC_Os07g14300.1	upstream_gene_variant ; 70.0bp to feature; MODIFIER	silent_mutation	Average:43.167; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg0708155828	G -> A	LOC_Os07g14310.1	downstream_gene_variant ; 4706.0bp to feature; MODIFIER	silent_mutation	Average:43.167; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N
vg0708155828	G -> A	LOC_Os07g14290-LOC_Os07g14300	intergenic_region ; MODIFIER	silent_mutation	Average:43.167; most accessible tissue: Minghui63 young leaf, score: 65.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708155828	5.49E-07	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	2.06E-06	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	NA	1.41E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	4.44E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	NA	1.32E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	4.63E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	1.36E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	5.26E-06	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	6.25E-07	NA	mr1145	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	3.75E-07	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	6.55E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	NA	1.68E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	1.66E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	5.60E-08	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	4.01E-09	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	5.32E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	1.21E-08	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	1.64E-07	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	7.50E-06	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	1.36E-08	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	8.11E-06	NA	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	NA	3.36E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	NA	1.57E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708155828	NA	1.78E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251