\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708152905:

Variant ID: vg0708152905 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8152905
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATTATAATCTTTCCACGGGATTAAACAAATGCGATACCCTTGGAATACTCTTGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAACT[C/T]
TGTAACCATAATATACTAGAAGTATTTCTGCGTCATTGCTGGGAATTATATTTCTAGTAATGTGTAACTATATTGGTATTTTCCTAATTCTTTCATATTG

Reverse complement sequence

CAATATGAAAGAATTAGGAAAATACCAATATAGTTACACATTACTAGAAATATAATTCCCAGCAATGACGCAGAAATACTTCTAGTATATTATGGTTACA[G/A]
AGTTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCAAGAGTATTCCAAGGGTATCGCATTTGTTTAATCCCGTGGAAAGATTATAATAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 11.70% 3.41% 1.29% NA
All Indica  2759 98.60% 0.70% 0.80% 0.00% NA
All Japonica  1512 67.60% 23.10% 6.48% 2.84% NA
Aus  269 42.80% 42.00% 9.67% 5.58% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 96.30% 1.30% 2.42% 0.00% NA
Temperate Japonica  767 87.40% 3.10% 8.08% 1.43% NA
Tropical Japonica  504 33.90% 54.40% 6.15% 5.56% NA
Japonica Intermediate  241 75.10% 21.20% 2.07% 1.66% NA
VI/Aromatic  96 25.00% 58.30% 13.54% 3.12% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708152905 C -> DEL N N silent_mutation Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124 N N N N
vg0708152905 C -> T LOC_Os07g14290.1 upstream_gene_variant ; 2047.0bp to feature; MODIFIER silent_mutation Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124 N N N N
vg0708152905 C -> T LOC_Os07g14300.1 upstream_gene_variant ; 2993.0bp to feature; MODIFIER silent_mutation Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124 N N N N
vg0708152905 C -> T LOC_Os07g14290-LOC_Os07g14300 intergenic_region ; MODIFIER silent_mutation Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708152905 3.74E-08 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 3.83E-06 1.32E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 5.46E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 3.07E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 1.06E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 2.20E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 5.25E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 6.84E-06 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 6.10E-07 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 5.46E-06 NA mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 3.53E-07 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 5.84E-08 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 5.03E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 1.31E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 8.18E-08 NA mr1411 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 1.07E-07 NA mr1560 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 6.51E-06 NA mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 3.48E-09 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 7.39E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 7.08E-10 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 6.48E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 1.83E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 1.67E-10 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 1.64E-08 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 2.24E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 3.00E-10 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 NA 3.50E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905 2.50E-06 7.20E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251