Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708152905:

Variant ID: vg0708152905 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8152905
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTATTATAATCTTTCCACGGGATTAAACAAATGCGATACCCTTGGAATACTCTTGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAACT[C/T]
TGTAACCATAATATACTAGAAGTATTTCTGCGTCATTGCTGGGAATTATATTTCTAGTAATGTGTAACTATATTGGTATTTTCCTAATTCTTTCATATTG

Reverse complement sequence

CAATATGAAAGAATTAGGAAAATACCAATATAGTTACACATTACTAGAAATATAATTCCCAGCAATGACGCAGAAATACTTCTAGTATATTATGGTTACA[G/A]
AGTTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCAAGAGTATTCCAAGGGTATCGCATTTGTTTAATCCCGTGGAAAGATTATAATAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	11.70%	3.41%	1.29%	NA
All Indica	2759	98.60%	0.70%	0.80%	0.00%	NA
All Japonica	1512	67.60%	23.10%	6.48%	2.84%	NA
Aus	269	42.80%	42.00%	9.67%	5.58%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	96.30%	1.30%	2.42%	0.00%	NA
Temperate Japonica	767	87.40%	3.10%	8.08%	1.43%	NA
Tropical Japonica	504	33.90%	54.40%	6.15%	5.56%	NA
Japonica Intermediate	241	75.10%	21.20%	2.07%	1.66%	NA
VI/Aromatic	96	25.00%	58.30%	13.54%	3.12%	NA
Intermediate	90	77.80%	20.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708152905	C -> DEL	N	N	silent_mutation	Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124	N	N	N	N
vg0708152905	C -> T	LOC_Os07g14290.1	upstream_gene_variant ; 2047.0bp to feature; MODIFIER	silent_mutation	Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124	N	N	N	N
vg0708152905	C -> T	LOC_Os07g14300.1	upstream_gene_variant ; 2993.0bp to feature; MODIFIER	silent_mutation	Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124	N	N	N	N
vg0708152905	C -> T	LOC_Os07g14290-LOC_Os07g14300	intergenic_region ; MODIFIER	silent_mutation	Average:27.309; most accessible tissue: Minghui63 flower, score: 37.124	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708152905	3.74E-08	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	3.83E-06	1.32E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	5.46E-07	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	3.07E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	1.06E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	2.20E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	5.25E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	6.84E-06	NA	mr1086	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	6.10E-07	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	5.46E-06	NA	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	3.53E-07	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	5.84E-08	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	5.03E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	1.31E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	8.18E-08	NA	mr1411	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	1.07E-07	NA	mr1560	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	6.51E-06	NA	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	3.48E-09	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	7.39E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	7.08E-10	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	6.48E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	1.83E-08	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	1.67E-10	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	1.64E-08	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	2.24E-06	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	3.00E-10	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	NA	3.50E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708152905	2.50E-06	7.20E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251