Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708134630:

Variant ID: vg0708134630 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8134630
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGAAAAACGTTTAGGCTGTCGAAGCAAATCCATCAGGAGGACACCATGGCATCTGATGTTGTCTACTATGCATCAAAGAGATTACTGGTTGTTTCTATT[C/G]
CTTCTTTTTGGTTGAGATAATTTGCGTTAATATAATGTTTTCATAGAAGTGAGTCAATCTTGATTTGTTTGGTTAACACGGGTTATGTGTTGAACGTGTG

Reverse complement sequence

CACACGTTCAACACATAACCCGTGTTAACCAAACAAATCAAGATTGACTCACTTCTATGAAAACATTATATTAACGCAAATTATCTCAACCAAAAAGAAG[G/C]
AATAGAAACAACCAGTAATCTCTTTGATGCATAGTAGACAACATCAGATGCCATGGTGTCCTCCTGATGGATTTGCTTCGACAGCCTAAACGTTTTTCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.30%	10.60%	0.95%	4.21%	NA
All Indica	2759	96.50%	0.60%	0.47%	2.46%	NA
All Japonica	1512	69.20%	22.30%	0.93%	7.54%	NA
Aus	269	43.10%	51.30%	5.58%	0.00%	NA
Indica I	595	99.50%	0.00%	0.17%	0.34%	NA
Indica II	465	96.80%	1.50%	0.22%	1.51%	NA
Indica III	913	99.30%	0.00%	0.11%	0.55%	NA
Indica Intermediate	786	90.70%	1.10%	1.27%	6.87%	NA
Temperate Japonica	767	84.10%	1.20%	0.65%	14.08%	NA
Tropical Japonica	504	36.10%	62.50%	1.39%	0.00%	NA
Japonica Intermediate	241	91.30%	5.40%	0.83%	2.49%	NA
VI/Aromatic	96	80.20%	0.00%	2.08%	17.71%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708134630	C -> DEL	N	N	silent_mutation	Average:38.106; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0708134630	C -> G	LOC_Os07g14270.1	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:38.106; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0708134630	C -> G	LOC_Os07g14270.2	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:38.106; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0708134630	C -> G	LOC_Os07g14270.3	upstream_gene_variant ; 2335.0bp to feature; MODIFIER	silent_mutation	Average:38.106; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0708134630	C -> G	LOC_Os07g14260-LOC_Os07g14270	intergenic_region ; MODIFIER	silent_mutation	Average:38.106; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708134630	2.47E-09	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	1.35E-06	3.73E-08	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	7.83E-09	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	6.36E-09	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	6.38E-08	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	5.42E-06	5.95E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	6.31E-08	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.39E-07	NA	mr1086	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	9.37E-08	NA	mr1103	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.32E-06	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	1.82E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	9.51E-06	NA	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	5.37E-08	NA	mr1204	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	4.23E-07	4.23E-07	mr1204	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	1.38E-09	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	5.06E-06	2.64E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	1.35E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	7.41E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.52E-08	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	7.12E-06	NA	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.06E-07	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	3.89E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	3.97E-11	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	8.22E-07	NA	mr1949	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	5.58E-06	5.58E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	8.85E-10	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	1.71E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	1.59E-11	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	1.30E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	8.21E-07	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	7.29E-09	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	1.71E-12	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.17E-11	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	8.55E-07	NA	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.53E-13	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	4.67E-06	5.04E-09	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	2.60E-07	NA	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	4.53E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708134630	NA	2.94E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251