\
| Variant ID: vg0708118551 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 8118551 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTCACCTTGACCAACGAGAAGGGAGAAACCGTAGTGTACAAATCACTAGTCTCACCAAAGCAAGGGGTCTCCTTGAATCAGATTGAGGCGGAAATCCCA[G/A]
TGGTCACGAAGGAGAAGAATCCGAGGAAATTGGAAGAGATTCCCATAGTTTGCGAGTACCCAGAAGTCTTTCCTGAAGACCTCACTACCATGCCACCCAA
TTGGGTGGCATGGTAGTGAGGTCTTCAGGAAAGACTTCTGGGTACTCGCAAACTATGGGAATCTCTTCCAATTTCCTCGGATTCTTCTCCTTCGTGACCA[C/T]
TGGGATTTCCGCCTCAATCTGATTCAAGGAGACCCCTTGCTTTGGTGAGACTAGTGATTTGTACACTACGGTTTCTCCCTTCTCGTTGGTCAAGGTGACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.90% | 7.00% | 33.05% | 32.08% | NA |
| All Indica | 2759 | 2.10% | 0.30% | 50.82% | 46.79% | NA |
| All Japonica | 1512 | 66.10% | 20.60% | 1.98% | 11.24% | NA |
| Aus | 269 | 57.20% | 0.00% | 34.94% | 7.81% | NA |
| Indica I | 595 | 0.70% | 0.20% | 16.30% | 82.86% | NA |
| Indica II | 465 | 4.10% | 1.30% | 53.12% | 41.51% | NA |
| Indica III | 913 | 1.10% | 0.00% | 71.41% | 27.49% | NA |
| Indica Intermediate | 786 | 3.20% | 0.10% | 51.65% | 45.04% | NA |
| Temperate Japonica | 767 | 84.40% | 0.50% | 1.04% | 14.08% | NA |
| Tropical Japonica | 504 | 25.80% | 59.90% | 3.97% | 10.32% | NA |
| Japonica Intermediate | 241 | 92.50% | 2.50% | 0.83% | 4.15% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 11.46% | 10.42% | NA |
| Intermediate | 90 | 35.60% | 10.00% | 27.78% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0708118551 | G -> DEL | LOC_Os07g14250.1 | N | frameshift_variant | Average:8.734; most accessible tissue: Callus, score: 23.913 | N | N | N | N |
| vg0708118551 | G -> A | LOC_Os07g14250.1 | missense_variant ; p.Val536Met; MODERATE | nonsynonymous_codon ; V536M | Average:8.734; most accessible tissue: Callus, score: 23.913 | probably damaging |
2.247 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0708118551 | 2.63E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 8.01E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 4.63E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 2.07E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 4.17E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 9.79E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 3.51E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 1.28E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 1.11E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 1.58E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 8.45E-08 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 1.14E-09 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 3.33E-08 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | 1.58E-06 | 2.22E-11 | mr1800_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0708118551 | NA | 1.50E-08 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |