\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708099149:

Variant ID: vg0708099149 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8099149
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.32, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGCAACAATGTCGAGGCTTACGTCGACGACATCGTTGTCAAAACCAAGACAGGCGACTCATTGATTGACGATCTGCGGGAAACGTTCGACAACCTCC[A/G]
ACGATATCGCCTCATGCTCAATCCTGAGAAGTGCACGTTCGGAGTACCATCGGGCAAGCTGCTCAGATTCCTTGTCTCTGGCAGAGGAATAGAAGCAAAC

Reverse complement sequence

GTTTGCTTCTATTCCTCTGCCAGAGACAAGGAATCTGAGCAGCTTGCCCGATGGTACTCCGAACGTGCACTTCTCAGGATTGAGCATGAGGCGATATCGT[T/C]
GGAGGTTGTCGAACGTTTCCCGCAGATCGTCAATCAATGAGTCGCCTGTCTTGGTTTTGACAACGATGTCGTCGACGTAAGCCTCGACATTGTTGCCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 2.50% 35.06% 25.37% NA
All Indica  2759 4.20% 3.90% 52.81% 39.04% NA
All Japonica  1512 88.50% 0.10% 4.37% 7.01% NA
Aus  269 59.50% 1.10% 38.29% 1.12% NA
Indica I  595 1.50% 3.00% 23.70% 71.76% NA
Indica II  465 7.10% 4.30% 71.61% 16.99% NA
Indica III  913 3.80% 2.80% 63.31% 30.01% NA
Indica Intermediate  786 5.10% 5.60% 51.53% 37.79% NA
Temperate Japonica  767 85.40% 0.00% 1.43% 13.17% NA
Tropical Japonica  504 89.50% 0.40% 9.92% 0.20% NA
Japonica Intermediate  241 96.30% 0.00% 2.07% 1.66% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 52.20% 3.30% 30.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708099149 A -> DEL LOC_Os07g14210.1 N frameshift_variant Average:13.679; most accessible tissue: Minghui63 flower, score: 17.194 N N N N
vg0708099149 A -> G LOC_Os07g14210.1 missense_variant ; p.Gln200Arg; MODERATE nonsynonymous_codon ; Q200R Average:13.679; most accessible tissue: Minghui63 flower, score: 17.194 benign -0.768 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708099149 NA 2.53E-31 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 1.81E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 2.06E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 2.27E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 4.84E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 1.72E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 7.58E-34 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 1.39E-36 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 1.59E-19 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 9.52E-42 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 8.88E-19 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 8.90E-40 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 5.46E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 4.64E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 2.12E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 6.12E-06 1.87E-22 mr1581_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 8.95E-48 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 4.58E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 1.68E-12 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 5.26E-06 4.67E-07 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708099149 NA 2.41E-38 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251